ID: 941772738

View in Genome Browser
Species Human (GRCh38)
Location 2:169362041-169362063
Sequence GACCCTGTCTTTGTTCCCAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941772738_941772746 10 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772746 2:169362074-169362096 GCGCTGTCACCGAAACTGGCGGG No data
941772738_941772747 11 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772747 2:169362075-169362097 CGCTGTCACCGAAACTGGCGGGG No data
941772738_941772745 9 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772745 2:169362073-169362095 TGCGCTGTCACCGAAACTGGCGG No data
941772738_941772744 6 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772744 2:169362070-169362092 GGGTGCGCTGTCACCGAAACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941772738 Original CRISPR GACCCTGTCTTTGTTCCCAC GGG (reversed) Intronic
No off target data available for this crispr