ID: 941772745

View in Genome Browser
Species Human (GRCh38)
Location 2:169362073-169362095
Sequence TGCGCTGTCACCGAAACTGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941772738_941772745 9 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772745 2:169362073-169362095 TGCGCTGTCACCGAAACTGGCGG No data
941772735_941772745 15 Left 941772735 2:169362035-169362057 CCAACGCCCGTGGGAACAAAGAC No data
Right 941772745 2:169362073-169362095 TGCGCTGTCACCGAAACTGGCGG No data
941772732_941772745 29 Left 941772732 2:169362021-169362043 CCAGGAGCATCGGACCAACGCCC No data
Right 941772745 2:169362073-169362095 TGCGCTGTCACCGAAACTGGCGG No data
941772739_941772745 8 Left 941772739 2:169362042-169362064 CCGTGGGAACAAAGACAGGGTCT No data
Right 941772745 2:169362073-169362095 TGCGCTGTCACCGAAACTGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941772745 Original CRISPR TGCGCTGTCACCGAAACTGG CGG Intronic
No off target data available for this crispr