ID: 941772747

View in Genome Browser
Species Human (GRCh38)
Location 2:169362075-169362097
Sequence CGCTGTCACCGAAACTGGCG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941772739_941772747 10 Left 941772739 2:169362042-169362064 CCGTGGGAACAAAGACAGGGTCT No data
Right 941772747 2:169362075-169362097 CGCTGTCACCGAAACTGGCGGGG No data
941772735_941772747 17 Left 941772735 2:169362035-169362057 CCAACGCCCGTGGGAACAAAGAC No data
Right 941772747 2:169362075-169362097 CGCTGTCACCGAAACTGGCGGGG No data
941772738_941772747 11 Left 941772738 2:169362041-169362063 CCCGTGGGAACAAAGACAGGGTC No data
Right 941772747 2:169362075-169362097 CGCTGTCACCGAAACTGGCGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941772747 Original CRISPR CGCTGTCACCGAAACTGGCG GGG Intronic
No off target data available for this crispr