ID: 941773281

View in Genome Browser
Species Human (GRCh38)
Location 2:169364850-169364872
Sequence ATCCCAGAATAACGCAGAAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 118}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941773271_941773281 23 Left 941773271 2:169364804-169364826 CCGTACTAGCCAGCTGCGTTTGT 0: 1
1: 0
2: 0
3: 5
4: 46
Right 941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 118
941773275_941773281 14 Left 941773275 2:169364813-169364835 CCAGCTGCGTTTGTGTATGGGGC 0: 1
1: 0
2: 0
3: 3
4: 84
Right 941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 118
941773276_941773281 -8 Left 941773276 2:169364835-169364857 CCGACCCCGCCGTTAATCCCAGA 0: 1
1: 0
2: 0
3: 5
4: 54
Right 941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG 0: 1
1: 0
2: 1
3: 8
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941773281 Original CRISPR ATCCCAGAATAACGCAGAAG AGG Intergenic
901442918 1:9290489-9290511 TTTCCAGATTAACGCCGAAGGGG + Intergenic
901478032 1:9504407-9504429 ACCCCAGAAGAAAGCAGCAGTGG - Intergenic
902567622 1:17322856-17322878 ATACCAGAAGAAAGAAGAAGTGG - Intronic
906373270 1:45272492-45272514 ATCCCAGAATACCACAGACTGGG - Intronic
907634590 1:56120925-56120947 ATCCCAGGATAACCCAGGAAAGG - Intergenic
907695007 1:56716356-56716378 ATCACAGAGAAACTCAGAAGCGG + Intergenic
911085462 1:93973887-93973909 ATCACAGAAAAAGGCAGAGGGGG + Intergenic
916202480 1:162285139-162285161 GTCCCAGAAACACCCAGAAGAGG - Intronic
919223023 1:194656022-194656044 ATCCCAGAATTATGCTGAATTGG + Intergenic
920069163 1:203290092-203290114 ATCCCAGAAAGTCTCAGAAGAGG - Intergenic
920853213 1:209643205-209643227 ATACAAGAATAAAGCAGAAAGGG - Intronic
922922389 1:229317403-229317425 AACCCAGAAGAAAACAGAAGGGG - Intergenic
924174152 1:241372670-241372692 ATCTCAGCATCACTCAGAAGTGG - Intergenic
1064095709 10:12423125-12423147 GTCCTAGAAGAACACAGAAGCGG - Intronic
1069641074 10:69955852-69955874 AGCCCATAATAACACAGAGGAGG - Intronic
1069769421 10:70888161-70888183 ACCCCAGTATAAAGCAGAATCGG + Intronic
1075298025 10:121295122-121295144 ATCCCATAATGACACAGACGCGG + Intergenic
1077335466 11:2001727-2001749 ACCCCAGAATAAAGCAGCAGTGG + Intergenic
1080397515 11:31903465-31903487 GTCCAACAATAACCCAGAAGCGG + Intronic
1081680444 11:44998887-44998909 GTCCCAGAATATTGGAGAAGGGG - Intergenic
1081979648 11:47258277-47258299 GTCCCAGAATAACTCATGAGGGG + Exonic
1087911992 11:103764687-103764709 CTCCCAGAATAGCACAGAAAAGG + Intergenic
1090886201 11:130879058-130879080 GTCCTAGAATAATCCAGAAGAGG - Intronic
1202818450 11_KI270721v1_random:56909-56931 ACCCCAGAATAAAGCAGCAGTGG + Intergenic
1092730198 12:11524492-11524514 ATGCCAGAAAAACACAAAAGTGG + Intergenic
1093950864 12:25164134-25164156 CTCCCAGAAAAGCGGAGAAGGGG - Intronic
1098898119 12:76085045-76085067 TTCCCAGCACAACGCCGAAGGGG - Intergenic
1100211203 12:92400366-92400388 ATACCAAAATAAGGCTGAAGAGG - Intergenic
1103460766 12:121103038-121103060 ATCCCAGGATAAAGAAGATGTGG + Intergenic
1107386902 13:39920249-39920271 ATCTCAGAAAAATGCAGAGGAGG - Intergenic
1115702586 14:35969213-35969235 ATCTGAGAATAACACTGAAGAGG + Intergenic
1117735288 14:58762815-58762837 ATCCCAAAAGAAAGCAAAAGAGG - Intergenic
1117874206 14:60234706-60234728 ATAATAGAATAAGGCAGAAGTGG - Intergenic
1122535522 14:102459270-102459292 ATCCCAGAGTTACTCAGAAATGG - Intronic
1128878919 15:71225131-71225153 TTCCCAGAAAAATGAAGAAGAGG + Intronic
1131312752 15:91305840-91305862 AGGACAGAAGAACGCAGAAGGGG + Intergenic
1131497594 15:92926747-92926769 ATCCCAGATAAACGCAGATGAGG - Intronic
1131873683 15:96783584-96783606 ATCCCAGAAAGACACACAAGTGG - Exonic
1135349749 16:21718735-21718757 ATCCCAGAATAAACCAGGATGGG - Intronic
1138150914 16:54656088-54656110 ATCTCAGATTAATGCAGACGTGG - Intergenic
1141939220 16:87263528-87263550 AACCCAGAATGTCTCAGAAGTGG + Intronic
1149807421 17:59632005-59632027 ATCCCAGAATTAAGTAAAAGTGG + Intronic
1153233871 18:2967353-2967375 ATCCCAGAGTAACCTAGAGGTGG + Intronic
1155326204 18:24667373-24667395 ACCCCAGAATAACATAGGAGAGG - Intergenic
1158712608 18:59850523-59850545 AAATGAGAATAACGCAGAAGTGG - Intergenic
1159638272 18:70832686-70832708 ATTCCAGAATAATGAAGAGGAGG - Intergenic
1161232273 19:3180213-3180235 TCCCCAGAATCACACAGAAGCGG - Exonic
1166323099 19:42031512-42031534 AGCCCAGGTTAACTCAGAAGGGG - Intronic
1167101922 19:47409006-47409028 ACCCCAGAGAAACCCAGAAGTGG - Intronic
1167776445 19:51560728-51560750 CTAACAGAATAACGGAGAAGGGG - Intergenic
1168551220 19:57296785-57296807 TTCCCAGAATAATGAAGAGGAGG - Intergenic
925933039 2:8725865-8725887 ATCTCAGAAAAACGAAGAAAGGG + Intronic
926443937 2:12921258-12921280 CTCCCAGAATAAAGCAGCATCGG + Intergenic
926516583 2:13853806-13853828 TTCCCAGAATAACACAGAAGTGG + Intergenic
926841352 2:17084003-17084025 ATAGGAGAATAAGGCAGAAGAGG + Intergenic
927256610 2:21045019-21045041 AACCCAGGATCACTCAGAAGGGG + Intergenic
927914301 2:26925063-26925085 ATCCCAGAAGAAGGCACAAGTGG + Intronic
928215332 2:29356652-29356674 ATCCCAAAATCAGGCAGGAGTGG - Intronic
929321847 2:40553552-40553574 GTGCCATAATAACACAGAAGAGG + Intronic
930095988 2:47567584-47567606 ACCCCAGAATATCCCAGCAGGGG + Intronic
937524391 2:122749174-122749196 ATCCCTGAATACGGCAAAAGGGG - Intergenic
939083359 2:137687721-137687743 CTCCCAGAAAAGCGGAGAAGGGG + Intergenic
940093108 2:149944219-149944241 ATCCCAGAAAAAAGAAGAAATGG + Intergenic
941773281 2:169364850-169364872 ATCCCAGAATAACGCAGAAGAGG + Intergenic
948544915 2:238720656-238720678 AACCCAGTATTACACAGAAGAGG + Intergenic
948635001 2:239329194-239329216 CTCCCAGAAGGACTCAGAAGGGG + Intronic
1169551553 20:6706696-6706718 TTCCCAGAAAAATGCACAAGTGG - Intergenic
1172666930 20:36606513-36606535 AACTCAGAATAACTCTGAAGTGG + Intronic
1172941163 20:38655791-38655813 ATCCCAGAAAGACGCAGTGGAGG + Intergenic
1174530442 20:51208597-51208619 ATCCCACAATTACACAGCAGTGG - Intergenic
1174739002 20:52993991-52994013 TTCCAAGAATAACACAAAAGAGG + Intronic
1175326458 20:58132098-58132120 ATCCCAGGATGACCTAGAAGAGG + Intergenic
1177160549 21:17543152-17543174 ATCTCAGAATAAAGCAGAAATGG + Intronic
1177966120 21:27727789-27727811 AACCCAGAAGAAGGCAGAAAAGG + Intergenic
1178544639 21:33482473-33482495 ATAACAGAATAACACAGAACAGG + Intergenic
1182654391 22:31878248-31878270 GTCCAAGAATATGGCAGAAGTGG + Intronic
1182912966 22:34002898-34002920 ATTGCAGAACAACACAGAAGAGG - Intergenic
953556172 3:43948564-43948586 ATCTCAAAATAAGGCAGTAGCGG - Intergenic
954324300 3:49854373-49854395 ATTCAACAATAACGTAGAAGTGG + Intronic
956331182 3:68110877-68110899 ATCCCAGACCAAAGCAGAAAGGG - Intronic
957245954 3:77716487-77716509 TTCCAAGAGGAACGCAGAAGTGG - Intergenic
959145294 3:102536994-102537016 ATCCCAGAATTATTCAGAACTGG - Intergenic
959862041 3:111227295-111227317 ATCCCAGAGTATCCCAGAATTGG - Intronic
961370841 3:126429525-126429547 AACCCAAAAGAAAGCAGAAGAGG - Intronic
969120728 4:4908981-4909003 ATCCCAGAATAGCAGAGTAGAGG - Intergenic
971052563 4:22877695-22877717 ATCCCAGAAGCAAGCAGATGGGG + Intergenic
971382263 4:26109925-26109947 ATCCCAGAGTAGGGAAGAAGAGG - Intergenic
972855659 4:43103479-43103501 ATCCAAGAACAACACTGAAGGGG - Intergenic
974795031 4:66738037-66738059 ATCCCAGAAGAGTGAAGAAGTGG + Intergenic
977997403 4:103511622-103511644 ATTCCAGAAAAATGCAGAGGAGG - Intergenic
979574146 4:122266795-122266817 ATCCCTGTATGACTCAGAAGAGG - Exonic
982262460 4:153506901-153506923 ATCTGAGACTAACACAGAAGAGG + Intronic
982631174 4:157831221-157831243 ATCCCAAAATAAGAAAGAAGGGG - Intergenic
984521751 4:180810534-180810556 ATCCCAGAACAATGCAAGAGAGG - Intergenic
984735719 4:183105956-183105978 ACCACAGAATAATGTAGAAGAGG + Intronic
988662413 5:33286075-33286097 ATCACAGAATACCGCAGACTAGG - Intergenic
990616256 5:57511499-57511521 ATCAGAGAATCAGGCAGAAGTGG + Intergenic
992272414 5:75078820-75078842 TTCCCTCAATAACACAGAAGAGG + Intronic
1000398726 5:160802911-160802933 ATTCCAGAAAAAGGCAGGAGGGG + Intronic
1003409351 6:5849589-5849611 ACCCCAGGATAACTCAAAAGTGG - Intergenic
1003627037 6:7750848-7750870 ATCTCAGAATGGGGCAGAAGTGG - Intronic
1008748576 6:54703931-54703953 ATCACAAAATACCACAGAAGAGG + Intergenic
1014555623 6:122840770-122840792 CTCCCAGAAAAACAGAGAAGGGG - Intergenic
1014671781 6:124313566-124313588 ATCCCAGAATAGCAAGGAAGAGG - Intronic
1015470298 6:133597711-133597733 ATATCAGAATATCGCAGAATGGG - Intergenic
1015818491 6:137235007-137235029 ATCCCAGAAAGAGGCAGAAGTGG - Intergenic
1018635291 6:165854869-165854891 ATCGCAGAAACACACAGAAGAGG + Intronic
1023074559 7:36470198-36470220 AACCCAGAAAAACACAGAAGAGG - Intergenic
1023497059 7:40808798-40808820 ATTCCAGAGTTAGGCAGAAGAGG + Intronic
1023854975 7:44177319-44177341 ATCCCTGAAGAACTCAGCAGTGG + Intronic
1024279073 7:47703568-47703590 ATCCCAGAAGAAAGCATAAAGGG + Intronic
1024488045 7:49942960-49942982 AACCCAGAACAATCCAGAAGAGG - Intronic
1029568075 7:101352263-101352285 ATCCCAAAACAACGCAGGAATGG - Intergenic
1033195942 7:139327385-139327407 ATCACAGAATACCGCAGACTAGG + Intergenic
1036453249 8:8887368-8887390 ATCACAGAAAAATACAGAAGAGG + Intronic
1043285228 8:78519650-78519672 ATCCAAGAATAACATAGAAGAGG - Intronic
1053351073 9:37413573-37413595 ATCACAGAATACCGCAGACTGGG + Intergenic
1059128657 9:111721027-111721049 ATCCCATCATAAAGCACAAGAGG - Intronic
1059639655 9:116204353-116204375 ATCCCAGACTCACGCAGAGTTGG - Intronic
1060102616 9:120853922-120853944 ATCCCAGAATGATGCTGCAGAGG + Intergenic
1185990847 X:4892564-4892586 ATCCCAGAAAAGCAGAGAAGGGG - Intergenic
1187459810 X:19477009-19477031 ATTTCAGAATTAAGCAGAAGTGG - Intronic
1189988122 X:46571736-46571758 ATCCCAGCACAAGGCCGAAGTGG + Intergenic
1193901548 X:87183990-87184012 ATTCTACAATAAAGCAGAAGTGG - Intergenic
1197970526 X:132110477-132110499 ATCCCAGCAGAAGGCAAAAGGGG - Intronic
1199380771 X:147169651-147169673 ATACCAGAATAGCACTGAAGGGG - Intergenic
1202177129 Y:22108230-22108252 ATCCTAGGATAGGGCAGAAGTGG - Intergenic
1202214232 Y:22478154-22478176 ATCCTAGGATAGGGCAGAAGTGG + Intergenic