ID: 941773333

View in Genome Browser
Species Human (GRCh38)
Location 2:169365145-169365167
Sequence AAATTGCAACTGAATTAACC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 218}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941773333 Original CRISPR AAATTGCAACTGAATTAACC TGG (reversed) Intergenic
902103867 1:14016908-14016930 TAACTGCTCCTGAATTAACCCGG - Intergenic
902537312 1:17127213-17127235 AAAATGCAAAAAAATTAACCAGG + Intergenic
905714623 1:40137872-40137894 AAAATGCAAAAAAATTAACCAGG + Intergenic
905925994 1:41750327-41750349 AAATGGCAGCTGAATAAACGAGG + Intronic
907674779 1:56508391-56508413 AGATTACAACTCAATTAACAGGG + Intronic
907791213 1:57666560-57666582 AAATTGCAACTGCATTCTACAGG + Intronic
907933845 1:59024665-59024687 AATTGGCAACTAATTTAACCTGG - Intergenic
908590881 1:65631893-65631915 AAATTGAAAATGAATTAAAGAGG - Intronic
908842098 1:68290301-68290323 AATTTGAAACTGAATTCACTAGG - Intergenic
909006004 1:70277295-70277317 AAAATGCAAAAGAATTATCCGGG + Intronic
909854049 1:80505855-80505877 AAAATGCAAAAAAATTAACCAGG - Intergenic
910724244 1:90322016-90322038 AAATTGCACTTTAAGTAACCTGG + Intergenic
911777557 1:101833608-101833630 AAATTCCAAAAGAATTATCCAGG - Intronic
912114328 1:106386322-106386344 AAAGTGCAATTGAATTAAAAAGG + Intergenic
914909710 1:151774890-151774912 CAAATGCAACTGCCTTAACCAGG - Intronic
915338858 1:155165423-155165445 AAAATGCAACAAAATTAGCCAGG + Intergenic
915792139 1:158684270-158684292 GAATAGCAATTGAGTTAACCAGG + Intronic
916287640 1:163128520-163128542 AAATTGAAACTTAATAAAACTGG + Intronic
917047855 1:170883076-170883098 AAATTCCAACTGAGATAAACAGG + Intergenic
917339674 1:173962453-173962475 AATTTGAAACTGAAATAACTGGG + Intronic
918870733 1:189970500-189970522 AAACTGCAACTGACTTACCTGGG + Intergenic
919304778 1:195818302-195818324 AATTTGGAAGTGAATTCACCTGG + Intergenic
919581634 1:199383207-199383229 AAATTGCCAATGAAGTTACCTGG + Intergenic
920236710 1:204512060-204512082 ACATTAAAAATGAATTAACCAGG + Intergenic
921861206 1:220044234-220044256 AAAATGTAATTGAATTAAACTGG + Intronic
922410414 1:225368617-225368639 CAATTGCAAGAAAATTAACCCGG - Intronic
924582910 1:245336781-245336803 AAAATGCAACTTCATTAAACTGG + Intronic
924751816 1:246900624-246900646 AAAATGCAAGTGAATGAATCTGG - Intronic
924812576 1:247416276-247416298 AAATTCCTAGTGCATTAACCAGG - Intronic
1063503425 10:6575266-6575288 AAACTGCTATTGAATTCACCAGG - Intronic
1064274900 10:13896736-13896758 AAATTGAAACTTAAGTTACCTGG + Intronic
1064440159 10:15346254-15346276 AAATTAAAAATAAATTAACCAGG - Intronic
1064736889 10:18391164-18391186 AAATGCCAACTTAATTAACTTGG - Intronic
1065893950 10:30145041-30145063 GAAATGCAATTGAATCAACCAGG + Intergenic
1067123123 10:43491652-43491674 AAATGGCACCTGGATTTACCTGG + Intergenic
1068525026 10:58118352-58118374 AAATTGCACCTGAATAATCACGG - Intergenic
1073799141 10:107022255-107022277 AGAATGCAAGTTAATTAACCCGG - Intronic
1079540784 11:21571722-21571744 AATTTGAAACTGAAAGAACCAGG - Intronic
1086238516 11:84661109-84661131 AAATTGCAGGTGACTTTACCTGG - Intronic
1088555731 11:111058842-111058864 AAATTGCAACTGACTTGACAGGG + Intergenic
1089656512 11:119950856-119950878 AAATTGCATCTGATTAAAACAGG - Intergenic
1090106849 11:123862503-123862525 CAATGGTAACTGAATTCACCCGG - Intergenic
1091099372 11:132856254-132856276 AAATGGGAACTGATTTAACCTGG + Intronic
1091355067 11:134931170-134931192 AAAATGCAAATGAATACACCTGG + Intergenic
1092190846 12:6519493-6519515 AAATTATAAATAAATTAACCAGG - Intronic
1092650774 12:10632379-10632401 AAATTGCAAAAGCATTAAGCAGG + Intronic
1094441562 12:30483424-30483446 AAAATACAACTGAAATAAACAGG + Intergenic
1095298910 12:40559433-40559455 AAATTGCACCTGATGTAAACAGG + Intronic
1098707567 12:73709866-73709888 ACTTTGCAACAGAAATAACCAGG - Intergenic
1104516771 12:129434341-129434363 AAATTGTGACTGAATGAACATGG + Intronic
1106314332 13:28579778-28579800 AAAATCCAACTGCTTTAACCTGG + Intergenic
1110280764 13:73691688-73691710 AAGCTGCAACTGAATAAATCTGG - Exonic
1110541887 13:76715240-76715262 CAATTGCAACTGAACTATCTGGG + Intergenic
1110961905 13:81637283-81637305 TGATTGCATCTGAATTAATCAGG + Intergenic
1111330193 13:86755972-86755994 AAAATGAAAATGAATAAACCAGG - Intergenic
1111928797 13:94492252-94492274 AAACTTCAACTGAAATATCCAGG + Intergenic
1112179185 13:97060721-97060743 AAATTGCTACTAAAATAATCTGG - Intergenic
1112784282 13:102934718-102934740 AAAATGCAACAAAATTAGCCTGG + Intergenic
1114301362 14:21381768-21381790 AAAAGGCAAATAAATTAACCAGG - Intronic
1114721818 14:24890749-24890771 AAATTGAAACAGTATTAAACAGG + Intronic
1115653419 14:35420191-35420213 AAATTCCAAGTGAATTGCCCTGG + Intergenic
1116063180 14:39949999-39950021 AAAATGCAAATAAATTAGCCGGG - Intergenic
1116261480 14:42633957-42633979 AAATTGCAACAAATTTAACCAGG + Intergenic
1116324409 14:43513831-43513853 AAATAACAAGTGAAATAACCTGG + Intergenic
1116520753 14:45843927-45843949 AAATTGCAACAAAATGAAACAGG - Intergenic
1120252283 14:82072849-82072871 AGAGTTCAACTGAATTAACTTGG - Intergenic
1120360606 14:83496776-83496798 AAATTGCAAATCATTTAAACTGG + Intergenic
1124366690 15:29076947-29076969 CAATTGGAACTGGATTAGCCTGG - Intronic
1125467777 15:39971747-39971769 AAACTGTAACTGATTTAAGCTGG - Intronic
1126556103 15:49989175-49989197 AAATTAAAACTGATTTAAACTGG + Intronic
1130426208 15:83803502-83803524 AATTTGCCATTGAATTCACCAGG + Intronic
1130548058 15:84870716-84870738 AAATTCCAAGTGAAAGAACCTGG + Exonic
1130628833 15:85544492-85544514 AAAAAGCAACTGAATTGTCCTGG + Intronic
1132037164 15:98494045-98494067 CAATGGCAACTGACTTAACCAGG + Intronic
1134327809 16:13223017-13223039 AAATTGAAACTAAAATAACCAGG - Intronic
1135415583 16:22266059-22266081 AAATTGGAGCTGTATTAGCCGGG + Intronic
1137085287 16:36113170-36113192 AAATAGAAACTCAATGAACCAGG - Intergenic
1141014555 16:80436679-80436701 CAAAGGCAACTGAATTCACCAGG + Intergenic
1143003368 17:3810150-3810172 AAATTACATCTAAATTAAGCTGG + Intergenic
1144115064 17:12080799-12080821 CAATTACATCTGAATTATCCAGG - Intronic
1144418913 17:15077751-15077773 AATTGGCAACTGACTTTACCAGG + Intergenic
1150683566 17:67302464-67302486 AAATAGCAACTGTCTTAGCCTGG + Intergenic
1151026964 17:70688364-70688386 ATATAGTAACTGAATTTACCAGG - Intergenic
1154307223 18:13239484-13239506 AATTAGCTAGTGAATTAACCAGG + Intronic
1155452003 18:25973294-25973316 AAATTAAAAATGAATTAACTGGG - Intergenic
1155714974 18:28930736-28930758 AAATTGCAAATGAGTTTATCAGG + Intergenic
1156382634 18:36578073-36578095 AATTTGAACCTGAATTAAACAGG + Intronic
1156907270 18:42369040-42369062 ATATTACAACTAAATTAACTTGG - Intergenic
1159185664 18:64969780-64969802 AAATTGGATCTTAATCAACCAGG - Intergenic
1159353953 18:67312524-67312546 ATTTTCCAACTGAAATAACCAGG + Intergenic
1161838899 19:6666735-6666757 AAAATACAACAAAATTAACCGGG + Intronic
1165018160 19:32899427-32899449 AAATTTCAACTGTATTACCCTGG - Intronic
1166587741 19:43965885-43965907 AAATTGCAAGTGACCTAACCAGG + Exonic
1166590742 19:43996174-43996196 AAATTGCAAAAGACTTAACCAGG + Exonic
1166594329 19:44031898-44031920 AAATTGCAAGTGACTTAACCAGG + Exonic
1166597841 19:44066145-44066167 AAATTGCAAGTGATTTAACCAGG + Exonic
1166602188 19:44106477-44106499 AAATTGCAAGTGATTTAACCAGG + Exonic
1166604755 19:44130931-44130953 AAATTTCAAGTGACTTAACCAGG + Exonic
1166609298 19:44175579-44175601 AAATTGCAAATGACTTAACCAGG + Exonic
1166614900 19:44234795-44234817 AGGTTGCAAGTGAATTAACCAGG + Exonic
1166839758 19:45689874-45689896 AAAATGCAAACAAATTAACCAGG + Intronic
1167989048 19:53342273-53342295 AAAATGCAACTAAATTATCCGGG - Intronic
926769171 2:16352692-16352714 AAATGGCAAATGAGTTAAACTGG - Intergenic
928056232 2:28057981-28058003 AAAATGCAAAAAAATTAACCGGG + Intronic
928107829 2:28483613-28483635 AACTTTCAACTGCAGTAACCAGG - Intronic
930044403 2:47156235-47156257 AAATTGCACCTGAACTCACCAGG + Intronic
931102016 2:59012638-59012660 AAAATGCAGCTGAATAAAACTGG - Intergenic
931347641 2:61461230-61461252 AAAATGCAAAAGAATTAGCCAGG + Intronic
931976740 2:67651692-67651714 GAATGGCAACTGCATTAAGCTGG + Intergenic
931979807 2:67682613-67682635 AACGTGCAAATGAATTACCCGGG + Intergenic
932125760 2:69144378-69144400 AGATTGCTACTGAAGTCACCAGG + Intronic
935219874 2:101002914-101002936 AAATTGCCAATGAATGAAACAGG - Intronic
935686485 2:105688302-105688324 AAAATGCAAAAAAATTAACCGGG - Intergenic
936161159 2:110085102-110085124 AAAATACAACTAAATTAGCCGGG + Exonic
936183504 2:110286252-110286274 AAAATACAACTAAATTAGCCGGG - Intergenic
936642560 2:114331426-114331448 TATTTGCAACTGAATGAAACAGG + Intergenic
938059653 2:128242377-128242399 AAATTGAAAATAAAATAACCCGG - Intronic
940749118 2:157604150-157604172 AAATTACATCTCAATAAACCTGG - Intronic
940837483 2:158539602-158539624 AATTGGTAACTGAATTATCCTGG + Intronic
941425394 2:165338418-165338440 AAAATGCAACAAAATTAGCCAGG - Intronic
941491195 2:166144121-166144143 AAGTTGCTACTTAATTAACTAGG + Intergenic
941773333 2:169365145-169365167 AAATTGCAACTGAATTAACCTGG - Intergenic
941876650 2:170440590-170440612 AAAATGCAACTGAATTAGCTGGG + Intronic
942524472 2:176838689-176838711 AAAATGCAAATGAATTACCTTGG - Intergenic
942560978 2:177218220-177218242 AAAATGCAAAAAAATTAACCGGG - Intronic
943769449 2:191700619-191700641 AAATTGCAAGGAAATTAAACGGG + Intergenic
944282195 2:197910720-197910742 AAATTAACTCTGAATTAACCTGG - Intronic
945112919 2:206380392-206380414 AAAATGCAACTGAGATAAACTGG - Intergenic
947454327 2:230239605-230239627 AAAATACAAAAGAATTAACCGGG - Intronic
947649157 2:231769965-231769987 AAAATGAAACTGAAATAAGCTGG + Intronic
1169367835 20:5005463-5005485 AAATTTCAATCAAATTAACCAGG - Intronic
1170378821 20:15733383-15733405 AAATTAAATCTGAAATAACCTGG - Intronic
1170812104 20:19682092-19682114 AAAATACAACAAAATTAACCAGG + Intronic
1172341715 20:34163070-34163092 AAAATGCAACAAAATTAGCCGGG - Intergenic
1174074914 20:47927587-47927609 AAATTACAACTTAATGTACCAGG + Intergenic
1177843717 21:26263571-26263593 AAATTCCAACTGACTTTTCCTGG - Intergenic
1179475904 21:41643991-41644013 AAATTGTAACTCAATAAAGCTGG + Intergenic
1180903312 22:19390432-19390454 AAATTACAAAAAAATTAACCGGG + Intronic
1181117362 22:20641048-20641070 AAATTGCAGCTGGATTAAAAAGG + Intergenic
1183939268 22:41283940-41283962 AAATTGCATAAAAATTAACCAGG + Intronic
1184993931 22:48189001-48189023 AAATAGGAACTAAATAAACCCGG - Intergenic
949528619 3:4931294-4931316 AATCTGCAGCTGAAGTAACCAGG + Intergenic
950469542 3:13175928-13175950 AAATTGCAAGCTAATTACCCAGG - Intergenic
950992555 3:17455677-17455699 AAATTACAAAAAAATTAACCAGG + Intronic
951577238 3:24126396-24126418 AATTTCCTACTGAGTTAACCAGG + Intronic
955778731 3:62461608-62461630 AAATAGCAGCTGCATTAGCCAGG - Intronic
956040486 3:65140072-65140094 AAATTGCAGCTAAATACACCAGG - Intergenic
956166006 3:66398736-66398758 AAATACCAACTGAATTAACTGGG + Intronic
956804191 3:72792434-72792456 AAAAAGCAACTGGATTAACATGG - Intronic
959404208 3:105940632-105940654 AAATTACAAAAGAATTAGCCGGG - Intergenic
959737985 3:109682971-109682993 AAATTGCATCTGACTTAAGCTGG + Intergenic
960835225 3:121899177-121899199 AAATTTTCTCTGAATTAACCAGG - Intronic
962293995 3:134163860-134163882 AAAGTGCAATTAAATGAACCTGG + Intronic
966202132 3:177368383-177368405 AAATTACAAAAAAATTAACCGGG - Intergenic
966257458 3:177933622-177933644 AAGTGGCAGCTGAATTAACTTGG + Intergenic
966824046 3:183948860-183948882 AAATTACAAAAAAATTAACCAGG - Intronic
966984102 3:185164174-185164196 AAATTACAAAAGAATTAGCCAGG - Intergenic
967359312 3:188611507-188611529 CAATTGCAACAGATTTACCCAGG + Intronic
968026409 3:195446252-195446274 AATTTGCAACGCAATTAGCCAGG - Intergenic
968185238 3:196628746-196628768 AAAATGCAAAAGAATTAGCCAGG - Intergenic
968780422 4:2576256-2576278 AAATTACAAAAGAATTAGCCAGG - Intronic
971286159 4:25291731-25291753 AAATGGCAACTGAGGTATCCAGG - Intergenic
973626713 4:52779821-52779843 AATATGCAACAGAATTACCCTGG + Intergenic
974614095 4:64259153-64259175 AATGTCCAACTGAATTAACATGG - Intergenic
974617726 4:64311197-64311219 AATTTGCTGCTGACTTAACCAGG - Intronic
975088183 4:70368106-70368128 AAAATACAACAGAATTAGCCAGG - Intergenic
977104881 4:92869589-92869611 AAATAACAACTGAGTTACCCTGG + Intronic
979737841 4:124109990-124110012 AGATATCAACTGAATCAACCTGG - Intergenic
982699750 4:158647173-158647195 AAATTGCCACTGAATAAATCTGG - Exonic
986487866 5:8258427-8258449 AAGTTCAAACTGAATAAACCAGG - Intergenic
986632283 5:9785160-9785182 AAATGGCAACAGAACTCACCTGG - Intergenic
988154262 5:27430085-27430107 AAATATCAACTGAATTAGACTGG - Intergenic
989207432 5:38825033-38825055 AATTTACAACTGAAATCACCAGG - Intergenic
989311963 5:40029928-40029950 AAATTGCAACAGAGTTATTCTGG + Intergenic
989769247 5:45122831-45122853 AAATTGCCACTGCATTTAACTGG - Intergenic
994062486 5:95495820-95495842 AATGTGCAACTGAAGTCACCTGG - Intronic
994154127 5:96483435-96483457 AAATTCACACTGTATTAACCTGG + Intergenic
994429565 5:99640271-99640293 AGTTTGCAACTGAATTATCTAGG - Intergenic
994826021 5:104713462-104713484 AAATTGCAAGTGAATAATCATGG - Intergenic
995683343 5:114744828-114744850 AAATTGCAACTTATTTAAAGGGG + Intergenic
996501485 5:124221877-124221899 AAAATGCCACTGAGTTAACCAGG - Intergenic
999334862 5:150706744-150706766 AAATTGTTACTGAATTAAACTGG + Intergenic
1000049726 5:157551988-157552010 AAAATGCAAAAAAATTAACCAGG + Intronic
1001909958 5:175507810-175507832 AAAATGCAAAAAAATTAACCAGG + Intronic
1002462554 5:179382271-179382293 GATTTGCAACTGAATTTACAAGG - Intergenic
1007144207 6:39611145-39611167 AAAATGCAAAAGAATTAGCCAGG + Intronic
1008232461 6:49000098-49000120 CAGTTGCAACTGAGTTAACTTGG + Intergenic
1008980373 6:57476328-57476350 AAATTCCAGCTGAATTAAACAGG - Intronic
1009024734 6:57984821-57984843 AAATTCTAACTGAAATTACCAGG - Intergenic
1009168480 6:60369271-60369293 AAATTCCAGCTGAATTAAACAGG - Intergenic
1009681716 6:66901905-66901927 AAACAGAAACTGAAGTAACCAGG - Intergenic
1009793975 6:68442271-68442293 AAATTGCAAGTGATGTAGCCAGG + Intergenic
1010016695 6:71112800-71112822 AAATATCAACTGAATTTCCCAGG + Intergenic
1011073650 6:83413948-83413970 AAATTGAAAATAAATTAGCCAGG + Intronic
1011575481 6:88792995-88793017 AAATAACCACTGAATTAACTAGG + Intronic
1011654541 6:89538562-89538584 AAATTTCAGCAGAATTAAACAGG + Intronic
1011828320 6:91337522-91337544 AAATTATAACTGAATAACCCTGG + Intergenic
1012454655 6:99390852-99390874 AAATTGAAACTACATTAACTGGG - Intronic
1012498615 6:99863424-99863446 AAATTGCAGGTGAATTTTCCAGG + Intergenic
1013448511 6:110255678-110255700 CACTTGCAAATAAATTAACCAGG - Intronic
1013779380 6:113713211-113713233 AAAATGCAAAAGAATTAGCCAGG - Intergenic
1021433832 7:20591802-20591824 AAATTGCAACTAAACAAATCGGG - Intergenic
1022632360 7:32097321-32097343 ATATAGCTACTGAATTAACTAGG + Intronic
1028852836 7:95555697-95555719 AAATTGAAAATGAATTAAATTGG + Intergenic
1029357233 7:100061180-100061202 AAATTGAAAAAGAATTTACCAGG - Intronic
1029441242 7:100587757-100587779 AAATTGAAAATAAATTAGCCAGG - Intronic
1029795926 7:102894565-102894587 AAATTTGAAAAGAATTAACCAGG + Intronic
1030924045 7:115429395-115429417 AAATTGAAACTTTATTAACAAGG - Intergenic
1031041645 7:116844431-116844453 AAATTACAAAAAAATTAACCGGG + Intronic
1031558118 7:123203673-123203695 CAATAGCAATTGAATAAACCTGG - Intergenic
1031698694 7:124895409-124895431 AAATTGCATCTCATTTAACCAGG - Intronic
1033933391 7:146552028-146552050 AAAATGCAACTGATATAAGCTGG + Intronic
1034688386 7:152994410-152994432 AAATTACACCTCAATTAACCTGG + Intergenic
1034838820 7:154376642-154376664 CCATTGCAAGTCAATTAACCAGG - Intronic
1036099928 8:5768766-5768788 AAAGTGCAACTGAATTAAAATGG - Intergenic
1038303798 8:26381361-26381383 AAATTGCAACCATATAAACCCGG - Intergenic
1039815735 8:41093040-41093062 AAAATGCAGCTGAATAACCCAGG + Intergenic
1040949194 8:52919127-52919149 AAATAGCAACTGAAGGAAACAGG + Intergenic
1042849565 8:73203111-73203133 AAATTGCATTTGAATTCATCGGG - Intergenic
1042974785 8:74456141-74456163 AAATTGCAATTGTACTAACTAGG - Intronic
1045762328 8:105625442-105625464 AAATGGCCACTGAATTAAATTGG - Intronic
1046232021 8:111370493-111370515 AAATTGCAACAGAAATAAATTGG - Intergenic
1047020229 8:120768029-120768051 AAATTGCAACTGCATTCAATTGG + Intronic
1047273084 8:123381338-123381360 AAATTGCAAAAAAATTAGCCAGG + Intronic
1048966024 8:139615164-139615186 AAATAGCAACAGAAGTAGCCAGG + Intronic
1049985825 9:949858-949880 CATTTGCAACGGAATGAACCTGG - Intronic
1050115753 9:2261488-2261510 AAATTCCAACTCAATTTATCAGG + Intergenic
1050728035 9:8674976-8674998 AAATTACAAAAGAAATAACCAGG + Intronic
1050728545 9:8680517-8680539 AAATTGCTATTGAATTTACTAGG - Intronic
1051009450 9:12393608-12393630 AAAATGAAACTAAATTAACAGGG + Intergenic
1052660063 9:31417652-31417674 AAATTGGAACTGGATAAATCAGG + Intergenic
1053211478 9:36232435-36232457 AAATTCCAAATGACTTACCCTGG + Intronic
1053593742 9:39538530-39538552 AAATTGCAAGCAAATTAATCTGG - Intergenic
1053851529 9:42293581-42293603 AAATTGCAAGCAAATTAATCTGG - Intergenic
1054572508 9:66826423-66826445 AAATTGCAAGCAAATTAATCTGG + Intergenic
1054736401 9:68754952-68754974 AAATGGCAACTATATTTACCTGG + Intronic
1057860830 9:98639521-98639543 CAAATACAACTTAATTAACCTGG + Intronic
1185854237 X:3519454-3519476 AAAATGCAAATCAATTAGCCAGG - Intergenic
1186351498 X:8744324-8744346 AAATTGCAGCTGAATTAGCATGG - Intergenic
1186867825 X:13738502-13738524 AAATTGTAATTGAATGACCCAGG + Intronic
1192336897 X:70229007-70229029 AAATTCCAACTGGAAAAACCTGG + Intergenic
1194729655 X:97438894-97438916 CAAATGCAACTGAATTAAGCAGG - Intronic
1194869045 X:99104976-99104998 AAATTGCATCTGCATGAAACCGG - Intergenic
1197388564 X:125831091-125831113 AAATTACAACTGAAAGAACTAGG + Intergenic
1198445136 X:136705841-136705863 ATATTGCACCTTAATAAACCAGG + Intronic
1198923015 X:141751601-141751623 CCCTTGCCACTGAATTAACCTGG + Intergenic
1199146528 X:144375670-144375692 AAATTGCAGCAAAATTAGCCAGG + Intergenic
1200946735 Y:8848677-8848699 CACTTGCCACTGAATTAACCTGG + Intergenic
1201289945 Y:12413479-12413501 AAATTAAAAATAAATTAACCAGG - Intergenic