ID: 941775087

View in Genome Browser
Species Human (GRCh38)
Location 2:169384682-169384704
Sequence ATTGAGGAGCCAAATGAGTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941775087_941775091 -3 Left 941775087 2:169384682-169384704 CCTTACTCATTTGGCTCCTCAAT No data
Right 941775091 2:169384702-169384724 AATGGCAATAGTATTTCAATGGG No data
941775087_941775092 18 Left 941775087 2:169384682-169384704 CCTTACTCATTTGGCTCCTCAAT No data
Right 941775092 2:169384723-169384745 GGTTAACTCTTCATATAAAGAGG No data
941775087_941775090 -4 Left 941775087 2:169384682-169384704 CCTTACTCATTTGGCTCCTCAAT No data
Right 941775090 2:169384701-169384723 CAATGGCAATAGTATTTCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941775087 Original CRISPR ATTGAGGAGCCAAATGAGTA AGG (reversed) Intergenic
No off target data available for this crispr