ID: 941779483

View in Genome Browser
Species Human (GRCh38)
Location 2:169428468-169428490
Sequence TGGAAGTCCCAGCACTAGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941779483_941779490 12 Left 941779483 2:169428468-169428490 CCTAGCTAGTGCTGGGACTTCCA No data
Right 941779490 2:169428503-169428525 TGTAGAAAGATGCTGAAAATGGG No data
941779483_941779489 11 Left 941779483 2:169428468-169428490 CCTAGCTAGTGCTGGGACTTCCA No data
Right 941779489 2:169428502-169428524 ATGTAGAAAGATGCTGAAAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941779483 Original CRISPR TGGAAGTCCCAGCACTAGCT AGG (reversed) Intergenic
No off target data available for this crispr