ID: 941780054

View in Genome Browser
Species Human (GRCh38)
Location 2:169433875-169433897
Sequence GTAGAAGTGTAGGCCCAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941780054_941780056 -7 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780056 2:169433891-169433913 CTTCTACTTAGAATATGCTAAGG No data
941780054_941780061 22 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780061 2:169433920-169433942 AGTGGCCACTCCTGAAGGTGGGG No data
941780054_941780058 17 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780058 2:169433915-169433937 TGAGTAGTGGCCACTCCTGAAGG No data
941780054_941780057 4 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780057 2:169433902-169433924 AATATGCTAAGGCTGAGTAGTGG No data
941780054_941780060 21 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780060 2:169433919-169433941 TAGTGGCCACTCCTGAAGGTGGG No data
941780054_941780059 20 Left 941780054 2:169433875-169433897 CCACACTGGGCCTACACTTCTAC No data
Right 941780059 2:169433918-169433940 GTAGTGGCCACTCCTGAAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941780054 Original CRISPR GTAGAAGTGTAGGCCCAGTG TGG (reversed) Intergenic
No off target data available for this crispr