ID: 941781427

View in Genome Browser
Species Human (GRCh38)
Location 2:169449825-169449847
Sequence GAAAATACAAATATTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941781422_941781427 12 Left 941781422 2:169449790-169449812 CCAACATAGTGAAACCCCGTCTC 0: 3054
1: 45456
2: 135968
3: 143128
4: 90007
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data
941781421_941781427 17 Left 941781421 2:169449785-169449807 CCTGGCCAACATAGTGAAACCCC 0: 5858
1: 78435
2: 176064
3: 221734
4: 188168
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data
941781425_941781427 -4 Left 941781425 2:169449806-169449828 CCGTCTCTACTAAAAAAAAGAAA 0: 43
1: 3116
2: 23968
3: 255978
4: 266546
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data
941781424_941781427 -3 Left 941781424 2:169449805-169449827 CCCGTCTCTACTAAAAAAAAGAA 0: 42
1: 2922
2: 23276
3: 227163
4: 280063
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data
941781420_941781427 21 Left 941781420 2:169449781-169449803 CCAGCCTGGCCAACATAGTGAAA 0: 8963
1: 103499
2: 178183
3: 237474
4: 253532
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data
941781423_941781427 -2 Left 941781423 2:169449804-169449826 CCCCGTCTCTACTAAAAAAAAGA 0: 24
1: 2625
2: 16160
3: 146924
4: 283314
Right 941781427 2:169449825-169449847 GAAAATACAAATATTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941781427 Original CRISPR GAAAATACAAATATTCAGCT GGG Intergenic
No off target data available for this crispr