ID: 941787471

View in Genome Browser
Species Human (GRCh38)
Location 2:169514116-169514138
Sequence GGTCCAGCTGTCCCAGCTGC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941787468_941787471 3 Left 941787468 2:169514090-169514112 CCCAGTTGTTTGTGGACTGAGTG No data
Right 941787471 2:169514116-169514138 GGTCCAGCTGTCCCAGCTGCCGG No data
941787467_941787471 10 Left 941787467 2:169514083-169514105 CCAACATCCCAGTTGTTTGTGGA No data
Right 941787471 2:169514116-169514138 GGTCCAGCTGTCCCAGCTGCCGG No data
941787465_941787471 11 Left 941787465 2:169514082-169514104 CCCAACATCCCAGTTGTTTGTGG No data
Right 941787471 2:169514116-169514138 GGTCCAGCTGTCCCAGCTGCCGG No data
941787469_941787471 2 Left 941787469 2:169514091-169514113 CCAGTTGTTTGTGGACTGAGTGA No data
Right 941787471 2:169514116-169514138 GGTCCAGCTGTCCCAGCTGCCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941787471 Original CRISPR GGTCCAGCTGTCCCAGCTGC CGG Intronic