ID: 941809308

View in Genome Browser
Species Human (GRCh38)
Location 2:169739358-169739380
Sequence ATTAAATCCAGATTCTTTGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941809307_941809308 -5 Left 941809307 2:169739340-169739362 CCTTTAAAATCTGGCTGAATTAA No data
Right 941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG No data
941809305_941809308 9 Left 941809305 2:169739326-169739348 CCTCTGTTTAAAAACCTTTAAAA No data
Right 941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG No data
941809304_941809308 29 Left 941809304 2:169739306-169739328 CCTTTGTTAGTTGCTCTATTCCT No data
Right 941809308 2:169739358-169739380 ATTAAATCCAGATTCTTTGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941809308 Original CRISPR ATTAAATCCAGATTCTTTGT TGG Intronic
No off target data available for this crispr