ID: 941810760

View in Genome Browser
Species Human (GRCh38)
Location 2:169754125-169754147
Sequence GGGGGTTAATCTATCCATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941810760_941810770 15 Left 941810760 2:169754125-169754147 CCCTCATGGATAGATTAACCCCC No data
Right 941810770 2:169754163-169754185 TTCTCTGTTCCAATGAGAGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941810760 Original CRISPR GGGGGTTAATCTATCCATGA GGG (reversed) Intronic
No off target data available for this crispr