ID: 941812416

View in Genome Browser
Species Human (GRCh38)
Location 2:169768071-169768093
Sequence TGCAGGATCTGCAGGTCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 370
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 333}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941812416_941812420 4 Left 941812416 2:169768071-169768093 CCTTGGGACCTGCAGATCCTGCA 0: 1
1: 0
2: 3
3: 33
4: 333
Right 941812420 2:169768098-169768120 GCTGCCCAATTTACCAACTTCGG 0: 1
1: 0
2: 0
3: 4
4: 94
941812416_941812423 10 Left 941812416 2:169768071-169768093 CCTTGGGACCTGCAGATCCTGCA 0: 1
1: 0
2: 3
3: 33
4: 333
Right 941812423 2:169768104-169768126 CAATTTACCAACTTCGGCAAAGG 0: 1
1: 0
2: 0
3: 3
4: 54
941812416_941812425 17 Left 941812416 2:169768071-169768093 CCTTGGGACCTGCAGATCCTGCA 0: 1
1: 0
2: 3
3: 33
4: 333
Right 941812425 2:169768111-169768133 CCAACTTCGGCAAAGGTATCTGG 0: 1
1: 0
2: 0
3: 3
4: 53

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941812416 Original CRISPR TGCAGGATCTGCAGGTCCCA AGG (reversed) Intronic
900199776 1:1399255-1399277 TGCAGGGTCGGCAGCTCCCGCGG - Exonic
900210221 1:1451911-1451933 TGCGGCGTCTGCAGGTCCCCAGG + Intronic
900215771 1:1480732-1480754 TGCGGCGTCTGCAGGTCCCCAGG + Intronic
900392069 1:2438068-2438090 TGCTGGCTTTGCAGGTCCCTGGG + Intronic
900803034 1:4749203-4749225 GAGAGCATCTGCAGGTCCCAAGG - Intronic
900876509 1:5346507-5346529 AGCAAGTTCTGCAGGTGCCATGG + Intergenic
901787992 1:11637379-11637401 TGCAGTCTCTGCAGCTCCCAGGG + Intergenic
902633987 1:17723216-17723238 TACAGGCTCTTCTGGTCCCACGG + Intergenic
902797507 1:18808945-18808967 TCCAGGATTTGGAGGGCCCATGG - Intergenic
902890101 1:19436947-19436969 TCCAGGCTCCACAGGTCCCAAGG - Intronic
903379248 1:22885456-22885478 TGCAGGATCTGCAGCAGCCAAGG + Intronic
903760499 1:25694736-25694758 GGCAACATCTGCAGTTCCCAAGG - Intronic
904336795 1:29803012-29803034 TGGAGGATTTGCAGATCTCACGG + Intergenic
904678177 1:32211413-32211435 AGCAGGATCTGCCAGTTCCAGGG + Intronic
904884904 1:33729149-33729171 TGCATGATCTGTAGCTCCCCGGG - Intronic
905479328 1:38250298-38250320 TGGAGGGGCTGGAGGTCCCAGGG + Intergenic
905533142 1:38698098-38698120 TGCAGGATCTATGAGTCCCATGG - Intergenic
905547848 1:38814029-38814051 TGCAGGCTCTGGAGCACCCAGGG - Intergenic
906593338 1:47049034-47049056 TGCAAGGTCTGCAGGTCTGAAGG + Intronic
908246142 1:62228914-62228936 TGCCTGACCTGCAGGTCCTACGG - Intergenic
909833267 1:80221196-80221218 TGCAGCGTCTCCAGGTGCCAGGG - Intergenic
910333764 1:86105333-86105355 TGCAGCATCCCCAGGTTCCATGG - Intronic
910820196 1:91337663-91337685 CCCAGTATCTGCAGGTCACAGGG - Intronic
911309237 1:96273126-96273148 TGCAGGCTCTGCAGGAAGCAAGG + Intergenic
911858563 1:102914739-102914761 TGCTGGACCTCCAGGTGCCAAGG - Exonic
912744358 1:112232926-112232948 TGCAGGATATGCAAGTCCCCAGG + Intergenic
916452793 1:164937261-164937283 AGAAGTATCTGCACGTCCCAAGG + Intergenic
917979051 1:180258269-180258291 TGCAGGAAATGCAGGTACCTGGG + Intronic
918712818 1:187752068-187752090 TACAGTTTCTGCAGGCCCCAGGG - Intergenic
920307622 1:205029326-205029348 TGCAGGGACTGCGGGTCCCAAGG - Intergenic
920314394 1:205067086-205067108 TGCAGGATCTGCAAGGCACCAGG - Exonic
922698908 1:227746557-227746579 TGCATGAGCTGCAGGAACCAGGG + Intronic
924689266 1:246329759-246329781 TGTGGGATCTGAAGTTCCCATGG - Intronic
1062968706 10:1629633-1629655 TGCAGGATCTGCAGGTGCCCAGG - Intronic
1063953631 10:11246647-11246669 TGCAGGAGCAACTGGTCCCATGG - Intronic
1066649740 10:37643036-37643058 TGCTGGTTCTTCAGGACCCAAGG + Intergenic
1067572224 10:47379950-47379972 AGGAGGATCTGCAGGTGCAAAGG - Intronic
1068887106 10:62109096-62109118 TCCAGGACCTGCAGGACCCCAGG + Intergenic
1068911850 10:62387091-62387113 TGTATGTTCTGCAAGTCCCAGGG - Intronic
1069753625 10:70760552-70760574 TGCAGCATCTGCAGGGTCCTGGG - Exonic
1069885331 10:71620093-71620115 AGCATGATCTGCAGGTCCCTCGG + Intronic
1070817114 10:79331575-79331597 TGCAGGTTCTGAAGGTTCCCTGG - Intergenic
1071493715 10:86153785-86153807 GGCAGGATCTGCAGGCCTAATGG + Intronic
1073330849 10:102669103-102669125 TGCCAGATCTGGAGGTCTCAGGG + Intergenic
1073916408 10:108409599-108409621 TGCAAGATCTTCAGGCCCTAGGG + Intergenic
1075216481 10:120540630-120540652 TTCAGGATGTGCAGGGCCCAAGG - Intronic
1075418317 10:122282030-122282052 TGTAGGCTCTGCTGTTCCCAAGG - Intronic
1075666343 10:124233654-124233676 ACCAGGATCGGCAGGTCCCGTGG - Intergenic
1076113087 10:127875440-127875462 TGCAGAATCTGCAGGGTCCCAGG + Intergenic
1076392074 10:130110710-130110732 CGGAGGATCTGCAGGTTCCGGGG - Intergenic
1076493381 10:130879382-130879404 TTAAGGATCCTCAGGTCCCAGGG + Intergenic
1076555849 10:131321003-131321025 TGCAGGAGCTTCAGGACCCTTGG + Intergenic
1076597126 10:131630784-131630806 TGCAGGCTCTGCAGCCCACAGGG + Intergenic
1076774736 10:132688384-132688406 TTCAGGCTCTGCAGTTCCCAGGG - Intronic
1076797968 10:132807948-132807970 AGAAGGCTCTGCAGGCCCCATGG + Intergenic
1077148523 11:1056786-1056808 TGCAGGCTCTGCTGGTCGCCTGG - Intergenic
1077160996 11:1112861-1112883 TGCAGGGACTGCTGGGCCCAAGG - Intergenic
1077653453 11:3995847-3995869 TGCAGGATGTGCAGGTGGCCTGG + Intronic
1078142395 11:8701930-8701952 TGCAGGGCCTGGAGGTGCCAGGG - Intronic
1078934321 11:15938552-15938574 TGCTGGATCAGCATGTGCCAGGG - Intergenic
1081587925 11:44400020-44400042 TTCAGAAGCTGCAGATCCCAAGG + Intergenic
1081659076 11:44876980-44877002 TGCAGGCTCTGCAGGGGCCTGGG - Intronic
1081659533 11:44879562-44879584 AGTAGGATCGGCAGGTGCCAAGG + Intronic
1083632048 11:64100831-64100853 AGGAGGCTCTGCAGGCCCCAGGG + Intronic
1083719561 11:64597700-64597722 TGAAGGACCTGCAGGAGCCAAGG + Intronic
1083949831 11:65947777-65947799 TGCAGCTTCTCCAGGTCCCATGG - Exonic
1084010455 11:66345463-66345485 GGAAGGGTCTGCAGGTTCCATGG - Exonic
1084315392 11:68342703-68342725 GGCAGGAGCGGCAGGCCCCAGGG - Intronic
1084698371 11:70769913-70769935 TCCAGCACCTGCAGGACCCAGGG - Intronic
1085301374 11:75460828-75460850 TGAAGGAGCTGCAGGTCTCCAGG + Intronic
1085475696 11:76787538-76787560 TGCAGGATCAGCAGGTTAGATGG - Intronic
1088095576 11:106096825-106096847 TGAAGGATCTTCAGGTGTCATGG - Exonic
1088287635 11:108204540-108204562 GGCAGGTTCGGCAGGTTCCAGGG - Intronic
1089864213 11:121617605-121617627 TGTAGGAGCTGCAGGATCCATGG - Intronic
1090048844 11:123359557-123359579 AGCAGGATATGCAGGCGCCAAGG + Intergenic
1091174067 11:133544216-133544238 GCCAGGATCTGCAGGTGCCAAGG + Intergenic
1091797066 12:3303597-3303619 AGCAGGAGCTGCTTGTCCCAGGG + Intergenic
1091845211 12:3650592-3650614 ACCAGGATCTTCAGCTCCCAGGG - Intronic
1096975656 12:55698019-55698041 TGCAATATCTGCAGGGCACAGGG + Exonic
1098227039 12:68335011-68335033 TGCAGGATCAGAAGGCCCAAAGG - Intergenic
1099139959 12:78960639-78960661 TGCAGGATCCGCAGGTACCCAGG + Intronic
1099165390 12:79300404-79300426 TTTAGGATCTCCAGGTCCCTAGG + Intronic
1099580761 12:84444270-84444292 TGCAGGAGCTTCAGTTCCCATGG - Intergenic
1101402976 12:104404352-104404374 GGCTGGATCTGCAGTTCCCAGGG - Intergenic
1101902626 12:108802321-108802343 TGGAGGAACTGCAGGGCTCAGGG - Exonic
1102761392 12:115388511-115388533 TGCAGGATGTACAGGTAACACGG - Intergenic
1102965432 12:117121630-117121652 TGCAGGATCTGCGGGTGCTATGG + Intergenic
1105807848 13:23967795-23967817 TGCAGAATGTGCAGGTACCATGG + Intergenic
1105954511 13:25268160-25268182 TGTAGGAGATGCAGTTCCCAGGG - Intronic
1107058258 13:36130000-36130022 TGCTGGACCTGGAAGTCCCAAGG + Intronic
1112579705 13:100668040-100668062 AGCAGGAACTGCAGCGCCCATGG + Intronic
1113203200 13:107889137-107889159 TGCAGGCTCTGCAGGAAGCATGG + Intergenic
1113401173 13:109994731-109994753 TGTAGTATCTTCAGGTCCCTAGG - Intergenic
1113850971 13:113417813-113417835 TGCAGGCACTGCAGCTCCCCTGG - Intergenic
1113953016 13:114082274-114082296 TGCAGCGTCTGCAGGTGCCCTGG + Intronic
1116492767 14:45526178-45526200 TCCAGTACCTGCAGGTCACAGGG - Intergenic
1118791590 14:69098224-69098246 TGCAGGATCTGTAAGTACTACGG - Intronic
1119542713 14:75451240-75451262 TGCAGGATCTGGAGGCCTCCTGG + Intronic
1119644186 14:76336689-76336711 TGCAGGAGCTGCAGTTCCCTGGG + Intronic
1121175772 14:91889733-91889755 TGCTGCATCAGCAGGGCCCATGG - Intronic
1121331949 14:93055327-93055349 TGGAGGATTTGCAGGGCCAAAGG + Intronic
1121713324 14:96055176-96055198 TCCCTGCTCTGCAGGTCCCATGG + Intronic
1122897362 14:104766696-104766718 TGAAGGCTCTGCAGGTCTCTGGG - Intronic
1123434490 15:20245119-20245141 TGGTGGATCTGCAGGTCACGTGG - Intergenic
1123570699 15:21604954-21604976 TTCAGAGCCTGCAGGTCCCAAGG + Intergenic
1123606812 15:22040307-22040329 TTCAGAGCCTGCAGGTCCCAAGG + Intergenic
1123792633 15:23737628-23737650 TTCAGGAAGTGCAGGTACCATGG + Intergenic
1124636996 15:31371750-31371772 TGCTGAAGCTGCAGGGCCCATGG - Intronic
1125508165 15:40279240-40279262 TGCATAATCGGCAGGTCCCAAGG + Intronic
1125511760 15:40296024-40296046 TGCAGGCTCTGTGGCTCCCAGGG - Intronic
1127303580 15:57681256-57681278 TCCTGGATCACCAGGTCCCATGG + Intronic
1127484417 15:59405941-59405963 TGCAGGAGCTCCAGGACCCTAGG - Intronic
1129150475 15:73684759-73684781 TCCGGGGTCTGCAGGTCCGACGG - Intronic
1129372326 15:75105320-75105342 TGCCAGATCAGCAGGTCCCTTGG - Intronic
1129394765 15:75237743-75237765 TGCATCATCTGCTGGCCCCATGG - Intergenic
1129835551 15:78703173-78703195 TGTTGGCTCTGCAGGGCCCAAGG + Intronic
1202979052 15_KI270727v1_random:332077-332099 TTCAGAGCCTGCAGGTCCCAAGG + Intergenic
1136417670 16:30113586-30113608 GGCAGGCTCAGCAGGTCCCAGGG - Exonic
1136654281 16:31700671-31700693 TCCAGTACCTGCAGGTCACAGGG - Intergenic
1138268754 16:55679698-55679720 TGAAGGAACAGAAGGTCCCAAGG + Intronic
1138291122 16:55847568-55847590 GACAGGCTCTGCAGGTACCAGGG + Intronic
1138310527 16:56019807-56019829 TGCAGCATCTGGAGGCCCAAGGG - Intergenic
1138369087 16:56510250-56510272 GGCAAGATGTGCAGCTCCCATGG - Intronic
1139231654 16:65288956-65288978 TGCAGTATCTGTAGGTACTATGG + Intergenic
1139346889 16:66309582-66309604 TGCAGTATCTGCAGGAACCTGGG + Intergenic
1139658464 16:68403940-68403962 TGCAGGAACGCCAGGTCCCAGGG + Intronic
1141300615 16:82812245-82812267 TGCTGGATCTGCAGGTCCAGAGG + Intronic
1141474510 16:84263720-84263742 TGCAGCATCTGCAGATCACTGGG - Intergenic
1144630080 17:16866926-16866948 AGCAGGAACTGCTGGTTCCAGGG + Intergenic
1144651294 17:17008870-17008892 AGCAGGAACTGCTGGTTCCAGGG - Intergenic
1144996891 17:19275871-19275893 TGGAGGCTCTGGAGCTCCCAGGG + Intronic
1145291036 17:21546059-21546081 TGCTGGAGCTGTGGGTCCCAGGG - Intronic
1145294682 17:21578800-21578822 AGCAGGATCTGCAGGCTCCAAGG - Intergenic
1145311255 17:21702269-21702291 TGCAGGTTCTGCATGTCCTGGGG + Intronic
1145369150 17:22294374-22294396 AGCAGGATCTGCAGGCTCCAAGG + Intergenic
1147315212 17:39617151-39617173 TGCGGGGTCTGCTGGTCCTACGG - Intergenic
1148218354 17:45846129-45846151 TGAAGACTCTGCAGGGCCCAAGG - Exonic
1150125489 17:62632110-62632132 TGACAGATCTGCAGGGCCCAGGG - Intronic
1150652924 17:67021631-67021653 CACAGGCTCTGCTGGTCCCAGGG + Intronic
1150867437 17:68868225-68868247 TGCTGCCTCTGCAGCTCCCAGGG + Intronic
1151681955 17:75627031-75627053 TGGAGGATCTGAGGGTCCCCTGG + Exonic
1152224682 17:79087241-79087263 TGCAGGAGCTGCAGGACCCGCGG + Intronic
1152439007 17:80293917-80293939 TGCAGGCCCTGCTGGGCCCAGGG + Intronic
1152937996 17:83151906-83151928 TGCAGGAACTGCGGGTGGCAGGG + Intergenic
1156445397 18:37233046-37233068 TGCAGTCTATGCAGGTCTCATGG - Intergenic
1156457619 18:37303649-37303671 TGCTGGCTCTCCAGGTCCCCAGG + Intronic
1157892021 18:51426872-51426894 TGCAGGCTCTGCAGGAATCATGG - Intergenic
1158213332 18:55074183-55074205 TGCAGGACTTTCAGGGCCCATGG + Intergenic
1159366496 18:67472464-67472486 TGCTGGCTGTGCAGGTCTCATGG - Intergenic
1159421665 18:68228737-68228759 TGCATTATCTTCATGTCCCAAGG + Intergenic
1160321485 18:77900223-77900245 TGCAGGAGCTGCAGGAGCCCCGG + Intergenic
1162338136 19:10074170-10074192 AGCAGGTTGTGCAGGTCCCCTGG - Intergenic
1162739944 19:12768100-12768122 TGCAGGAACTGCAGGGCCAGCGG - Exonic
1163061372 19:14764552-14764574 GGCAGGGTCTCCAGGTCCCCAGG + Exonic
1164283597 19:23790708-23790730 TCCAGTACCTGCAGGTCACAGGG - Intronic
1166293726 19:41878910-41878932 TGCTGGAACTGCAGGGGCCAGGG + Intronic
1166558947 19:43719388-43719410 TCCAGGCCCTGCCGGTCCCAGGG + Exonic
1166802726 19:45468309-45468331 TGCAGGCTCCGTAGGACCCAGGG - Exonic
1166992715 19:46702510-46702532 TCCAGAATCTGCAGATTCCAAGG + Intronic
1168115102 19:54217983-54218005 TGCTGTGTCTGCAGCTCCCATGG + Intronic
1168120795 19:54251675-54251697 TGCTGTGTCTGCAGCTCCCATGG + Intronic
1168124374 19:54275572-54275594 TGCTGTGTCTGCAGCTCCCATGG + Intronic
1168177613 19:54635966-54635988 TGCTGTGTCTGCAGCTCCCATGG - Intronic
1168181890 19:54667106-54667128 TGCTGTGTCTGCAGCTCCCATGG - Intronic
925023166 2:587753-587775 AGCTGGGTCTGCAGCTCCCAGGG - Intergenic
925582717 2:5427673-5427695 TGCAGCATCTTCAGTTTCCATGG - Intergenic
926298740 2:11587412-11587434 TGCAGGTTCTGCCGGACCAAGGG - Intronic
928335925 2:30398159-30398181 TGCAGGATGAGGATGTCCCAGGG + Intergenic
928800581 2:35085856-35085878 AACAGGATCTGCAGGTCCTGTGG - Intergenic
928922046 2:36536517-36536539 TGCTGGATCTGCTGGTCCTTGGG + Intronic
929624667 2:43394510-43394532 AGCTGGCTCTGGAGGTCCCATGG + Intronic
932082752 2:68730713-68730735 TGCAGGAGCTGCTGGGGCCAGGG - Intronic
933220642 2:79683746-79683768 TGCAGGAGCTGCAGGTGCTGGGG + Intronic
933448106 2:82408655-82408677 AGCAGGAGCAGCAGGTCACATGG + Intergenic
933813990 2:86051468-86051490 TGCAGCAGCTGCAGGTCCACAGG + Intronic
936039876 2:109141908-109141930 TGCAAGCTCTGCAGGTGGCAGGG + Intronic
936286962 2:111188243-111188265 TGTATAATCTGCAGTTCCCATGG - Intergenic
937598168 2:123695330-123695352 TGGAGAAGCTGCAGGTGCCATGG + Intergenic
938163890 2:129009636-129009658 TGCAGTATCTCCAGGCCACAGGG - Intergenic
938299170 2:130198184-130198206 TCCTGGATCTGCAGGTCCCAGGG - Intronic
939219050 2:139278991-139279013 TGGAAGCTCTGCAGGTGCCAGGG + Intergenic
939877053 2:147589310-147589332 TCCAGCAGCTTCAGGTCCCATGG - Intergenic
941293881 2:163711567-163711589 TTCAGGAACTGCAGGTTACATGG - Intronic
941812416 2:169768071-169768093 TGCAGGATCTGCAGGTCCCAAGG - Intronic
942090114 2:172481672-172481694 TGCAAGGTCTGCAGGTCCCATGG - Intronic
943529163 2:189057328-189057350 TGCAGGAACTCCTGGCCCCAAGG - Exonic
947960882 2:234236275-234236297 AGCAGGATATGCAGTTCCCCAGG + Intergenic
948276100 2:236709896-236709918 TGCAGGCTGTACAGGACCCATGG - Intergenic
948515113 2:238498781-238498803 TGTGGGATGTGCAGGTCCGAGGG + Intergenic
948827820 2:240581938-240581960 TGCAGGATGTGAAGGTCTGATGG - Intergenic
949026276 2:241767877-241767899 TGCATGAGCTGCAGGGCCCCCGG - Exonic
1168841618 20:913572-913594 TGCAGGATCAGAAGGTCACCTGG - Intronic
1169604596 20:7302492-7302514 TGGAGGATCAGCTGTTCCCATGG + Intergenic
1169756524 20:9048818-9048840 TGCAGGATTTGCATATCCTACGG - Intergenic
1169860804 20:10150495-10150517 TGCAGGCTCTGCAGGAGGCATGG + Intergenic
1171460705 20:25296478-25296500 GGCGGGATCTGCAGGTCGGAGGG - Exonic
1171991559 20:31700456-31700478 TGTAGGATCTTCAAGTGCCAGGG - Intronic
1172155399 20:32820312-32820334 TGCAGCGACTGGAGGTCCCAGGG + Intronic
1172563072 20:35906497-35906519 ACCAGGATCTGAAGGTCCCTGGG + Intronic
1172767332 20:37357862-37357884 TGCAGGAACAGCAGGTGCAAAGG + Intronic
1174336615 20:49866136-49866158 TGCAGGATCAGTGGGTGCCAGGG - Intronic
1174337097 20:49870457-49870479 AGCAGGAACTGCAGGAGCCAGGG + Intronic
1174528743 20:51194175-51194197 TCCAGGCACTCCAGGTCCCACGG + Intergenic
1174554303 20:51382878-51382900 TCCAGGATCTGAAGGTGCAAGGG - Intergenic
1174853666 20:54021865-54021887 TGCAGGATGTGCAGGAGCCCGGG - Intronic
1175132046 20:56796619-56796641 TTGAGGATCCGCAGGACCCAGGG + Intergenic
1176664067 21:9668029-9668051 TGCCTGATTTGCAGGGCCCAGGG + Intergenic
1177774272 21:25550531-25550553 TGCCGGATCATCAGGCCCCAGGG - Intergenic
1179719436 21:43306883-43306905 AGCAAAATCTCCAGGTCCCAAGG + Intergenic
1180046178 21:45306778-45306800 TGCAGGCTCTGCTGGTCCTAGGG + Intergenic
1180087474 21:45514432-45514454 TGCTGGAGCTGCTGGACCCAGGG - Exonic
1180610988 22:17097850-17097872 AGCTGGATCTGCAGGTCCTTTGG - Exonic
1180629045 22:17214628-17214650 TGCTGGTCCTGCAGGCCCCAGGG + Intronic
1182076054 22:27496186-27496208 TACAGGAGTTGCAGGGCCCAAGG - Intergenic
1183397002 22:37577265-37577287 TGCAGGATGTGAATGTGCCAGGG - Intronic
1184267818 22:43359143-43359165 TGCAGGTTGTGGAGGTGCCATGG + Intergenic
1184808536 22:46812458-46812480 TGCAGGCTCTGGGGCTCCCACGG + Intronic
1185054576 22:48572495-48572517 AGCAGGGTCAGCAGGTCCAAAGG - Intronic
1185116767 22:48942315-48942337 TCCAGACTCTGCAGATCCCAGGG + Intergenic
1185307132 22:50125516-50125538 TGCTGGTTCTGGAGGTCCCAGGG + Exonic
949299905 3:2571513-2571535 TGCAGTACCAGCAGTTCCCATGG - Exonic
953141543 3:40233933-40233955 AGCAGGATCTACAGGGCCCTGGG + Exonic
953422372 3:42764510-42764532 TGCAGCATCTGGAGGTGGCAGGG - Intronic
953836886 3:46354262-46354284 TGCAGGCTTTGCAGTTCCCCAGG - Intronic
954754686 3:52832761-52832783 TGCAGGCTCTGCAGCACCTAGGG - Intronic
954916582 3:54153099-54153121 TGCAGAATGTGCAGGGCACAGGG + Intronic
955595288 3:60583398-60583420 TTCAGGTTCTTCAGGCCCCACGG + Intronic
956904382 3:73750466-73750488 GGCAGGGTCTGCTGGACCCATGG + Intergenic
957948082 3:87089562-87089584 TGCAGGATCAGTGGGTCCTAGGG - Intergenic
959433883 3:106288719-106288741 TTCAGAACCTGCAGTTCCCAGGG - Intergenic
960975496 3:123169853-123169875 GGGAGGATCTGCAGGACCAAGGG + Intronic
961626730 3:128269295-128269317 GGCAGGGCCTGCAGGCCCCATGG + Intronic
962483309 3:135816447-135816469 TGCTGGTTCTTCAGGGCCCATGG - Intergenic
962607432 3:137044425-137044447 TGCAGGATCTCCAGGCCCATAGG - Intergenic
967551093 3:190796677-190796699 TGCAGGTTATTCAGGGCCCAGGG - Intergenic
968933656 4:3597783-3597805 TGCAGGAGCCTCAGGTCCCCCGG - Intergenic
969458179 4:7312965-7312987 TGGAAGATCAGCAGGTCCCCTGG - Intronic
969724390 4:8910737-8910759 GGCAGGATTTGCAAGTTCCAGGG - Intergenic
973678090 4:53286513-53286535 TGCAGGAGCTCCAGGTCCTTGGG - Intronic
974893283 4:67907485-67907507 TGCTGGTTCTTCAGGGCCCAAGG + Intergenic
975335445 4:73170397-73170419 TGCTGGTTCTTCAGGGCCCAAGG - Intronic
976876271 4:89856973-89856995 TGCAGGCTCTGCTGGTACCCAGG + Intergenic
980932388 4:139194340-139194362 TGGAAGAGCTGCAGGTCCCTAGG + Intergenic
981454068 4:144933526-144933548 TGCAGCTTCTGCAGGGTCCACGG - Intergenic
981530825 4:145752324-145752346 TGCTGGTTATGCAGGACCCAAGG + Intronic
981698230 4:147580485-147580507 TGCAGGCTGTACAGGTTCCAGGG + Intergenic
983779164 4:171646042-171646064 AGGAGAATGTGCAGGTCCCAGGG - Intergenic
985122468 4:186657999-186658021 TGCAGGCGCTGCAGCTGCCAAGG + Intronic
985384754 4:189434034-189434056 TGCTGGTTCTTCAGGACCCAAGG + Intergenic
985409526 4:189668709-189668731 TGCCTGATTTGCAGGGCCCAGGG + Intergenic
985903378 5:2814294-2814316 GGCAGGGTCCGCAGGGCCCAAGG + Intergenic
987575261 5:19719633-19719655 TGCAGGTTCTGTTGGTTCCAAGG - Intronic
988129372 5:27082427-27082449 TGCAGGAACTGCTGGCCTCATGG + Intronic
989628948 5:43461256-43461278 TGCTGGTTGTTCAGGTCCCAAGG - Intronic
990214251 5:53513399-53513421 TGCTGGTTATGCAGGGCCCAAGG + Intergenic
994201357 5:96979711-96979733 TTCAGGCTCTTCAGGTCACATGG + Exonic
996147734 5:119996233-119996255 AGGAGGAGCTGCAGGGCCCAGGG - Intergenic
997211348 5:132078831-132078853 CGCAGGATAGGCAGGTCCCGTGG - Intergenic
997859088 5:137400304-137400326 TGCAGACTCTGCAGCTCCCCAGG + Intronic
998215057 5:140231706-140231728 TGTAGGAACAGCAGGTGCCAAGG + Intronic
999414995 5:151387278-151387300 AGCAGGCTCTGGAGGACCCATGG + Intergenic
1003118203 6:3297477-3297499 GTCAGGATCTCCAGGTGCCAGGG + Intronic
1003183518 6:3811478-3811500 TGCAGGAGCTGCAGGACGCTTGG + Intergenic
1006447057 6:34085471-34085493 GGCAGGAGGTGGAGGTCCCAGGG + Intronic
1006608420 6:35276695-35276717 TGCAGGAGCCACAGGGCCCAGGG + Intronic
1007313920 6:40969100-40969122 AGCAGGGTTTGCAGGTCCCAAGG + Intergenic
1007598557 6:43067061-43067083 AGCAGGATGGTCAGGTCCCAAGG - Exonic
1011697344 6:89924265-89924287 GTCAGGATCTGCAGGAACCAGGG + Intergenic
1011752049 6:90463376-90463398 TTAAGGAGCTGCATGTCCCATGG - Intergenic
1012448003 6:99326500-99326522 TGTAGCATTTGAAGGTCCCATGG + Intronic
1015791015 6:136964620-136964642 TCCAGGTCCTGCAGGTCTCAGGG + Intergenic
1017114838 6:150966964-150966986 TGCAGGATGCACAGGTGCCAAGG + Intronic
1017816094 6:158017748-158017770 TGCAGGAGGAGCAGGTCCCGAGG - Intronic
1018395243 6:163373417-163373439 TGCAGGAGCGGCAGGTCCGAGGG + Intergenic
1019571931 7:1716882-1716904 AGGAGGATCTGCAGGGGCCAGGG + Intronic
1019646792 7:2134812-2134834 GGCATGATCTCCAGGCCCCAGGG + Intronic
1024021233 7:45372877-45372899 TGCAGGATGTGCAGCTCCTAGGG + Intergenic
1024512544 7:50215052-50215074 TGCAAGGTCTGCAGGGACCAAGG - Intergenic
1025139148 7:56448264-56448286 TCCAGTACCTGCAGGTCCCAGGG + Intergenic
1025173480 7:56782624-56782646 TCCAGGTTTTGCAGGGCCCACGG + Intergenic
1025698623 7:63795547-63795569 TCCAGGTTCTGCAGGGCCCACGG - Intergenic
1026969207 7:74457759-74457781 TGAAGCCTCTGCAGGCCCCATGG - Intronic
1029704170 7:102267108-102267130 TGCAGGATCTACAGGTGCAGAGG + Intronic
1029940860 7:104479307-104479329 TGCAGGATTAACAGCTCCCATGG - Intronic
1030087672 7:105830792-105830814 CCCAGGAAGTGCAGGTCCCATGG - Intronic
1033416067 7:141162207-141162229 AGCAGGAGCTGCAGGGCGCAAGG - Intronic
1035125817 7:156607353-156607375 TGCGGCATCCGCAGGTCCCGTGG + Intergenic
1035132751 7:156670646-156670668 TGGGAAATCTGCAGGTCCCAGGG - Intronic
1037770324 8:21795124-21795146 TGCAGCTGCTGCAGCTCCCATGG + Intronic
1038857459 8:31349055-31349077 TGCAATCTCTGCAGGTCTCAGGG - Intergenic
1039215807 8:35269458-35269480 TGCAGAATTCGCAGCTCCCACGG + Intronic
1040523698 8:48199528-48199550 TGCAGGAGGTGCATTTCCCAGGG - Intergenic
1041462738 8:58129742-58129764 TGCAGGGTCTCCAGTGCCCACGG + Intronic
1044726999 8:95202164-95202186 TGCAGCAGCTTCAGGTCCCGGGG - Intergenic
1045281165 8:100750775-100750797 TGCAGGATGTACAAGTCACATGG + Intergenic
1045423627 8:102041451-102041473 TGCAGGAACTGCAGGATCTAAGG + Intronic
1047023839 8:120806257-120806279 TCCAGGATCTCCAGGTTCCCTGG - Intronic
1047668882 8:127122927-127122949 TGCAGGAGCTCCAGCTTCCAAGG - Intergenic
1048327653 8:133451575-133451597 TGCAGGAGGTGCAGTTCCAAGGG + Intergenic
1049340565 8:142110144-142110166 TGCTGGATCTGCTGGTCAGATGG - Intergenic
1049340569 8:142110178-142110200 TGCTGGGTCTGCTGGTCACAGGG - Intergenic
1049858498 8:144880451-144880473 CACAGGATCTGCAGGTCATAAGG + Exonic
1052042714 9:23757580-23757602 TGCAGCATCAGCAGGTGTCAAGG + Intronic
1053445613 9:38150786-38150808 AGCAGGATCTGCAGGCCACCTGG + Intergenic
1053469743 9:38337853-38337875 TGCAGATCCTGAAGGTCCCAGGG + Intergenic
1053484704 9:38442966-38442988 TGCAGGAAGGGCAGGTGCCAGGG - Intergenic
1054456491 9:65434033-65434055 TGCAGGAGCCTCAGGTCCCCAGG + Intergenic
1054935111 9:70678494-70678516 TACAGAATATGCAGATCCCAAGG + Intronic
1056682709 9:88733033-88733055 TACTGTATCTTCAGGTCCCAGGG - Intergenic
1056683137 9:88737485-88737507 TCCAGGATCTGCAGATCACCAGG + Intergenic
1056789208 9:89614878-89614900 TGCAGGAGCTGGGGGTCCCTCGG + Intergenic
1056825795 9:89875587-89875609 TGCCAGCTGTGCAGGTCCCAAGG + Intergenic
1057289083 9:93788980-93789002 TGCTGGTTCTTCAGGGCCCAAGG + Intergenic
1057724586 9:97559172-97559194 GGCAGGCTCTCCAGCTCCCACGG - Intronic
1060204143 9:121672619-121672641 TCCAGGATCAGCTGGTCCCATGG + Intronic
1061852589 9:133424664-133424686 TGCAGGGTGTGCATGTGCCATGG - Intronic
1203662033 Un_KI270753v1:53723-53745 TGCCTGATTTGCAGGGCCCAGGG - Intergenic
1186435701 X:9541483-9541505 TGCAGGAGCAGCAGGAACCAAGG + Intronic
1186455103 X:9704430-9704452 TGCAGAATCTCCCGCTCCCATGG - Intronic
1186911704 X:14174369-14174391 TGCTGGTTATTCAGGTCCCAAGG + Intergenic
1187135816 X:16546200-16546222 GGCAGGATCTGAAGGCCCCCAGG - Intergenic
1187594499 X:20756332-20756354 TGCAGGTTATTCAGGGCCCAAGG + Intergenic
1187707051 X:22019469-22019491 TGAAGGATCTGCAGTGCCAAGGG + Intergenic
1188284470 X:28311340-28311362 TGCAAAATCTGTAGGGCCCAAGG - Intergenic
1189105234 X:38228803-38228825 GGAAGGATCTGCAGGTCAAAGGG - Intronic
1189627760 X:42917714-42917736 TGCAAAATTTGCAGATCCCAGGG - Intergenic
1190172130 X:48120009-48120031 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190177782 X:48165670-48165692 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190189667 X:48266762-48266784 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190196894 X:48327386-48327408 TGCAGGGTCTGCAGGTCAGGAGG + Intergenic
1190199363 X:48347105-48347127 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190204590 X:48392664-48392686 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190205946 X:48402739-48402761 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190260093 X:48792063-48792085 TGAAGGCAGTGCAGGTCCCAGGG - Exonic
1190659904 X:52644740-52644762 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190663631 X:52677748-52677770 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190666132 X:52697587-52697609 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190673286 X:52760823-52760845 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190675792 X:52780674-52780696 TGCAGGGTCTGCAGGTCAGGAGG - Intronic
1190676827 X:52789604-52789626 TGCAGGGTCTGCAGGTCAGGAGG + Intronic
1190914326 X:54799149-54799171 CTCAGGATCTGCAGGTCCTGTGG + Intergenic
1192210362 X:69123852-69123874 TGGAGGTAATGCAGGTCCCAGGG + Intergenic
1192505679 X:71680697-71680719 TGCAGGTTCCTCAGGGCCCAAGG + Intergenic
1193468295 X:81872370-81872392 AGCAGGATTGGCAGGTCCCATGG - Intergenic
1194129386 X:90061453-90061475 TGCAGGATGTACAGGTAGCATGG - Intergenic
1195021215 X:100830826-100830848 TGCAGGCCCGGCGGGTCCCACGG - Intronic
1195136180 X:101909241-101909263 TGCTGGTTATTCAGGTCCCAAGG - Intronic
1199606794 X:149584880-149584902 CCCAGGATCAGCAGGACCCAAGG - Intronic
1199632329 X:149784488-149784510 CCCAGGATCAGCAGGACCCAAGG + Intronic
1199635149 X:149806672-149806694 CCCAGGATCAGCAGGACCCAAGG + Intergenic
1199786793 X:151113041-151113063 CCCAGTATCTGCAGGTCACAGGG + Intergenic
1199875022 X:151922140-151922162 CCCAGGATCTACAGGACCCAAGG + Intronic
1199897255 X:152137229-152137251 CCCAGAATCTGCAGGACCCAAGG - Intronic
1199947676 X:152681272-152681294 CCCAGCATCTGCAGGACCCACGG + Intergenic
1199950035 X:152699700-152699722 CCCAGGATCTGCAGGGCCCAAGG + Intronic
1199952230 X:152715572-152715594 CCCAGGATCTGCCGGACCCAAGG + Intronic
1199954865 X:152734763-152734785 CCCAGGATCTGCCGGACCCAAGG + Intronic
1199957453 X:152752876-152752898 CCCAGGATCTGCCGGACCCAAGG - Intronic
1199959639 X:152768761-152768783 CCCAGGATCTGCAGGGCCCAAGG - Intronic
1199962003 X:152787182-152787204 CCCAGCATCTGCAGGACCCACGG - Intergenic
1200686856 Y:6265725-6265747 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1200765821 Y:7079892-7079914 TGCAGAATCTCCTGCTCCCATGG - Intronic
1200989733 Y:9336641-9336663 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1200992401 Y:9356974-9356996 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1200995053 Y:9377252-9377274 TGCGGGATCTGCGGGTCCAGCGG - Intronic
1200997718 Y:9397598-9397620 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1201000228 Y:9466132-9466154 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1201002889 Y:9486444-9486466 TGCGGGATCTGCGGGTCCAGCGG - Intronic
1201005545 Y:9506727-9506749 TGCGGGATCTGCGGGTCCAGCGG - Intergenic
1201008208 Y:9527057-9527079 TGCGGGATCTGCGGGTCCAGCGG - Intergenic