ID: 941821738

View in Genome Browser
Species Human (GRCh38)
Location 2:169850467-169850489
Sequence GATCCAGAGCAGGCCGGGTG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941821738_941821747 30 Left 941821738 2:169850467-169850489 CCGCACCCGGCCTGCTCTGGATC No data
Right 941821747 2:169850520-169850542 TGTAAGAGTTTTAGGTGAAGGGG No data
941821738_941821742 22 Left 941821738 2:169850467-169850489 CCGCACCCGGCCTGCTCTGGATC No data
Right 941821742 2:169850512-169850534 ATTTGCCCTGTAAGAGTTTTAGG No data
941821738_941821746 29 Left 941821738 2:169850467-169850489 CCGCACCCGGCCTGCTCTGGATC No data
Right 941821746 2:169850519-169850541 CTGTAAGAGTTTTAGGTGAAGGG No data
941821738_941821745 28 Left 941821738 2:169850467-169850489 CCGCACCCGGCCTGCTCTGGATC No data
Right 941821745 2:169850518-169850540 CCTGTAAGAGTTTTAGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941821738 Original CRISPR GATCCAGAGCAGGCCGGGTG CGG (reversed) Intronic
No off target data available for this crispr