ID: 941826936

View in Genome Browser
Species Human (GRCh38)
Location 2:169909132-169909154
Sequence CCTTTTAAGGAATTTGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941826924_941826936 29 Left 941826924 2:169909080-169909102 CCCAAAGTGCTGGGATTACAGGC 0: 215700
1: 270647
2: 186590
3: 142154
4: 223611
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data
941826929_941826936 -2 Left 941826929 2:169909111-169909133 CCACGCCCGGCCTTGATTGGTCC No data
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data
941826925_941826936 28 Left 941826925 2:169909081-169909103 CCAAAGTGCTGGGATTACAGGCG 0: 121435
1: 268139
2: 223994
3: 153979
4: 220861
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data
941826930_941826936 -7 Left 941826930 2:169909116-169909138 CCCGGCCTTGATTGGTCCTTTTA No data
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data
941826931_941826936 -8 Left 941826931 2:169909117-169909139 CCGGCCTTGATTGGTCCTTTTAA No data
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data
941826927_941826936 1 Left 941826927 2:169909108-169909130 CCACCACGCCCGGCCTTGATTGG No data
Right 941826936 2:169909132-169909154 CCTTTTAAGGAATTTGTGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941826936 Original CRISPR CCTTTTAAGGAATTTGTGGC TGG Intronic
No off target data available for this crispr