ID: 941835998

View in Genome Browser
Species Human (GRCh38)
Location 2:170021530-170021552
Sequence GGGGCCTTTGAGAAGTGATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 6525
Summary {0: 8, 1: 135, 2: 772, 3: 2086, 4: 3524}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941835998_941836007 5 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836007 2:170021558-170021580 CTTATACTAACCTTGGGGTTAGG No data
941835998_941836011 30 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941835998_941836009 26 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941835998_941836010 29 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941835998_941836004 0 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836004 2:170021553-170021575 ACCTCCTTATACTAACCTTGGGG No data
941835998_941836003 -1 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836003 2:170021552-170021574 CACCTCCTTATACTAACCTTGGG No data
941835998_941836002 -2 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836002 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941835998 Original CRISPR GGGGCCTTTGAGAAGTGATT AGG (reversed) Intronic
Too many off-targets to display for this crispr