ID: 941836000 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:170021550-170021572 |
| Sequence | CAAGGTTAGTATAAGGAGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941836000_941836010 | 9 | Left | 941836000 | 2:170021550-170021572 | CCCACCTCCTTATACTAACCTTG | No data | ||
| Right | 941836010 | 2:170021582-170021604 | CTTCAACATATGAATTTTGGTGG | 0: 154 1: 911 2: 2311 3: 3605 4: 4287 |
||||
| 941836000_941836011 | 10 | Left | 941836000 | 2:170021550-170021572 | CCCACCTCCTTATACTAACCTTG | No data | ||
| Right | 941836011 | 2:170021583-170021605 | TTCAACATATGAATTTTGGTGGG | 0: 24 1: 357 2: 1394 3: 2605 4: 3444 |
||||
| 941836000_941836009 | 6 | Left | 941836000 | 2:170021550-170021572 | CCCACCTCCTTATACTAACCTTG | No data | ||
| Right | 941836009 | 2:170021579-170021601 | GGACTTCAACATATGAATTTTGG | 0: 148 1: 1017 2: 2212 3: 3420 4: 4021 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941836000 | Original CRISPR | CAAGGTTAGTATAAGGAGGT GGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||