ID: 941836001

View in Genome Browser
Species Human (GRCh38)
Location 2:170021551-170021573
Sequence CCAAGGTTAGTATAAGGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941836001_941836011 9 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836001_941836009 5 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836001_941836010 8 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836001 Original CRISPR CCAAGGTTAGTATAAGGAGG TGG (reversed) Intronic
No off target data available for this crispr