ID: 941836005

View in Genome Browser
Species Human (GRCh38)
Location 2:170021554-170021576
Sequence ACCCCAAGGTTAGTATAAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941836005_941836009 2 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836005_941836011 6 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836005_941836010 5 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836005 Original CRISPR ACCCCAAGGTTAGTATAAGG AGG (reversed) Intronic
No off target data available for this crispr