ID: 941836008

View in Genome Browser
Species Human (GRCh38)
Location 2:170021568-170021590
Sequence ATGTTGAAGTCCTAACCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1025
Summary {0: 5, 1: 41, 2: 152, 3: 277, 4: 550}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941836008_941836013 29 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836013 2:170021620-170021642 TCCATTGCAGTTTTTTTTAAGGG No data
941836008_941836011 -8 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836008_941836010 -9 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941836008_941836012 28 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836012 2:170021619-170021641 GTCCATTGCAGTTTTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836008 Original CRISPR ATGTTGAAGTCCTAACCCCA AGG (reversed) Intronic
900311856 1:2037266-2037288 AAGTTGAAATCCTGCCCCCAGGG - Intergenic
900340895 1:2188595-2188617 AGGTTGAAATCCTCACCACAAGG - Intronic
900702304 1:4055879-4055901 AGGTTGAAATCCTAACCCCCAGG + Intergenic
900746871 1:4366563-4366585 AGGTTGAAGTCCTAACACCCAGG + Intergenic
900825918 1:4926881-4926903 ATGTTGAAGTCTTAACCCCCAGG + Intergenic
900837016 1:5012828-5012850 CTGCTGAAGTCCTAACCCCAAGG + Intergenic
901195460 1:7437588-7437610 ACGTTGAAGTCCTAGCCCCCAGG - Intronic
901197605 1:7448819-7448841 ATGCTGAAATCCTGACCCCGAGG - Intronic
901327652 1:8378427-8378449 ACGTTGAAGCTCTAACCCCCAGG + Intronic
901467599 1:9432629-9432651 ATGTTGAAGCCTTAACCCCCAGG - Intergenic
901576539 1:10205608-10205630 GTCTTGAACTCCTAACCTCAAGG - Intergenic
902142129 1:14365499-14365521 ATGTTGACGTTTTAACCCCCAGG - Intergenic
902224921 1:14990773-14990795 ATGTTGAAGTCCTAACCCCCAGG + Intronic
902320072 1:15656056-15656078 ATTTTGAACTCCTGACCTCAAGG + Intronic
902422262 1:16290286-16290308 ATGGTGAAGCCCTAACGCCAAGG + Intronic
902590770 1:17472795-17472817 ATCTTGAACTCCTGACCTCAAGG + Intergenic
903441495 1:23391397-23391419 CTGTTGAAATCCTAACCCCAAGG + Intronic
903672896 1:25046934-25046956 CTGTTGAGCTCCCAACCCCAGGG + Intergenic
904539297 1:31222094-31222116 GTGTTGAACTCCTGACCTCAGGG + Intronic
905474511 1:38216645-38216667 GTGTGGAAGTCCTTGCCCCATGG + Intergenic
906010091 1:42514988-42515010 ATATTGAAGTCCTAACCCCCAGG + Intronic
906068723 1:43001915-43001937 ATGTTGAAATCCTAACCCCCAGG - Intergenic
906789053 1:48642748-48642770 ATGGTGAATTCCTAGCCTCAAGG - Intronic
906995864 1:50793567-50793589 ACGTTACAGTCCTAACTCCATGG - Intronic
907582916 1:55588043-55588065 ATGTTGAAGACCTAACCCCCAGG - Intergenic
908113299 1:60917951-60917973 GTGTTGAATTCCTAACTCCCGGG - Intronic
908151504 1:61307184-61307206 ATGTTGAAATCCTGACTCCATGG + Intronic
908168069 1:61477580-61477602 ATGCTGATGTCCTAACCCCCAGG - Intergenic
908439698 1:64141508-64141530 ATGTTGAATTGCAATCCCCAGGG - Intronic
908721744 1:67133573-67133595 ATGTTGAAGTCCTAGGCCCCAGG + Intronic
908786595 1:67740648-67740670 ATGTTGAAATCCTAACCCCATGG + Intronic
909187251 1:72503354-72503376 ATACTGAAATCCTAACCTCAAGG - Intergenic
909201652 1:72696826-72696848 CTGTTGATGGCCTACCCCCATGG - Intergenic
909239418 1:73193006-73193028 CTGTTGAAATCCTAACCACTTGG - Intergenic
909494940 1:76268059-76268081 AAATTGTAGTCCTATCCCCATGG + Intronic
909734961 1:78947197-78947219 TAGTTCAAGTCCTAACCCCAAGG + Intronic
910498877 1:87865560-87865582 AAGTTCACGTCCTAATCCCAGGG - Intergenic
910667789 1:89742911-89742933 GTATTGAAATCCTAATCCCAAGG - Intronic
910669639 1:89760512-89760534 ATGTTGAGATCTAAACCCCAAGG + Intronic
911123068 1:94315116-94315138 GTCTTGAACTCCTAACCTCAAGG - Intergenic
911497477 1:98649295-98649317 ATGTTGAAATCCTGACTCCCAGG - Intergenic
911687302 1:100792152-100792174 ATGTTAAAATCTTAACCCCCAGG - Intergenic
912284816 1:108357906-108357928 ATGTTGAAGGCCTAACCTCAGGG + Intergenic
912855570 1:113166059-113166081 ACGTTAAAGTCCTAACCCCCAGG - Intergenic
912958353 1:114172519-114172541 ACGCTGAAATCCTAACCCCAAGG + Intergenic
913085140 1:115429861-115429883 ATGTTGATATCTTACCCCCAAGG - Intergenic
914820190 1:151095814-151095836 GTCTTGAAGTCCTGACCTCAGGG - Intronic
915630064 1:157146703-157146725 ATGTTCAAGTCCTAACTCCCAGG + Intergenic
915739457 1:158107452-158107474 ATGTTGAAATCCTAACTCCAAGG - Intergenic
916002614 1:160631498-160631520 ATGTTGAAGCTCTAACCCCAAGG + Intronic
916983217 1:170162293-170162315 CGGTTGATGGCCTAACCCCACGG - Intronic
917468294 1:175304098-175304120 ATGTTGAAATTCTAACTCCAAGG - Intergenic
918318748 1:183345273-183345295 ATGTTGAAATTCAATCCCCATGG + Intronic
919046381 1:192457679-192457701 ATGTTGAACCCCTAATCCCCAGG - Intergenic
919537390 1:198805209-198805231 AGGTTAAAGTCCTAACTCCCAGG + Intergenic
919587292 1:199454824-199454846 GTCTTGCAGGCCTAACCCCATGG + Intergenic
920159914 1:203988743-203988765 ACGTCGAAGCCTTAACCCCAGGG + Intergenic
920202463 1:204267937-204267959 ATGCTGAATCCCCAACCCCATGG - Intronic
920651946 1:207844259-207844281 ATGTAAAAGTCCTCACCCCAAGG + Intergenic
921550188 1:216526232-216526254 ATGTTAGAGTCCTAACCTCCAGG + Intronic
922077252 1:222258293-222258315 ATGTTCAAATCCCAACCCAACGG + Intergenic
922422569 1:225469673-225469695 ATGCTGAAGTCCTAACCCCCAGG + Intergenic
922568496 1:226617594-226617616 TTGTTGAAGTCCTAATTCCCAGG + Intergenic
922978262 1:229802958-229802980 ATGTTGAAATCCTAACCCCCAGG + Intergenic
923006196 1:230052008-230052030 ATGTTGCAGTCCTAACCTCCAGG + Intergenic
923087259 1:230711098-230711120 GTGTTGAAGTCCTCAACCCCAGG + Intronic
923200945 1:231710840-231710862 ATGTTGGAGTTCTAACCCCCAGG - Intronic
923338893 1:232991499-232991521 CTGTTGAAGCCCTAACCCCCAGG + Intronic
923772805 1:236952065-236952087 ATGTTGGAATCCTAATCCCCAGG - Intergenic
923784712 1:237055727-237055749 ATGTTGACATCCTAATCCCCAGG + Intronic
924260359 1:242223279-242223301 GTGTTGAAATCCTAACCCCCAGG - Intronic
924796106 1:247293387-247293409 GTCTTGAACTCCTAACCTCAGGG - Intergenic
924797806 1:247305051-247305073 ATGTTGAAGTCCTAACCCTAAGG + Intronic
924800509 1:247326673-247326695 ATGTTGAAGCCCTAACCCTTAGG + Intronic
1062950036 10:1492277-1492299 ATGTTGGTGTCCTAACCCATGGG + Intronic
1062961777 10:1577757-1577779 ATGCTGAAGCCCTAACCCCCAGG + Intronic
1063089085 10:2845548-2845570 ATGTTGAAACCCAACCCCCAAGG - Intergenic
1063372593 10:5531590-5531612 ATGTTGAAGTCCTACCAACCAGG + Intergenic
1063716041 10:8528153-8528175 ATATTGAAGTCCTAACCTCCAGG + Intergenic
1064219084 10:13424526-13424548 ATGTTGAAATCCTAACCCCCAGG + Intergenic
1064495869 10:15909722-15909744 ATCTTGAACTCCTGACCTCAAGG + Intergenic
1064615963 10:17156604-17156626 ATGTTCAAGTAATAACCCAAAGG + Intronic
1065038072 10:21660654-21660676 ATCTTGAACTCCTGACCTCAGGG - Intronic
1065203684 10:23338271-23338293 TTGTTGAACTCCTGACACCATGG - Intronic
1065249816 10:23799255-23799277 ATGTTGAAATCCTAACCCCCAGG - Intronic
1065870584 10:29952892-29952914 ATCTTGAACTCCTGACCTCAAGG - Intergenic
1066064640 10:31753174-31753196 GTGTTGAAGTCCTGACCTCTAGG + Intergenic
1067150051 10:43724609-43724631 ACATTGAAGTCCTAACCCCAAGG + Intergenic
1067308381 10:45089203-45089225 GTGTTGAACTCCTAGCCTCAAGG + Intergenic
1067549813 10:47226371-47226393 ATGTTGAAGCCCCAAGCCCCAGG - Intergenic
1067656001 10:48191930-48191952 GTGTTCAAATCCTAACCCCTGGG + Intronic
1067872376 10:49973456-49973478 GTCTTGAACTCCTAGCCCCAAGG - Exonic
1068535427 10:58236146-58236168 ATCTTGAACTCCTGACCTCAAGG + Intronic
1068570632 10:58624316-58624338 ATGTTGAAGTACTAATGCCTGGG - Intronic
1069241694 10:66148403-66148425 ATGTTGAAATCTAATCCCCATGG + Intronic
1069361865 10:67652250-67652272 GTGTTGAAATCCTAACTCCCAGG - Intronic
1069689243 10:70338876-70338898 ATCTTGAACTCCTGACCTCAGGG + Intronic
1069737696 10:70668263-70668285 ATGTTAGAGGCCTACCCCCAGGG - Intergenic
1069747578 10:70725692-70725714 ATGTTGAAATCCAACTCCCAAGG - Intronic
1069940482 10:71951971-71951993 TTCTTGAAGTCCAAAACCCATGG - Intergenic
1070090923 10:73284443-73284465 ATGTTCATGTCCTAATCCCTGGG - Intronic
1070348868 10:75572764-75572786 ATGTTGAAGCCCTAGCTTCAGGG + Intronic
1070580712 10:77717133-77717155 ATGTTGAAATTCGATCCCCAGGG + Intergenic
1070682156 10:78456221-78456243 ATGCTAAAGTCCTAACCCCCAGG + Intergenic
1070916639 10:80159253-80159275 ATGTGGAAGTCCCAACTCCCAGG + Intronic
1070963475 10:80515515-80515537 ACACTGAAGTCCTAACCCCCAGG - Intronic
1070972799 10:80581407-80581429 ATTTTGAAGTCCTAATCCCCGGG + Intronic
1071008343 10:80909621-80909643 ATGTTGAAATTTTATCCCCAGGG - Intergenic
1071909821 10:90218844-90218866 ATGTTGAAGTTCTAACCTCCAGG - Intergenic
1071919983 10:90338596-90338618 ATGTTGAAATCCTAATCCCAAGG - Intergenic
1071924216 10:90387131-90387153 ATCTTGAACTCCTGACCTCAAGG + Intergenic
1072181960 10:92992070-92992092 GTCTTGAACTCCTGACCCCAGGG - Intronic
1072351754 10:94564025-94564047 ATCTTGAACTCCTGACCTCAGGG + Intronic
1073080926 10:100860231-100860253 GTGTTGAAATTCTAATCCCAAGG - Intergenic
1074302651 10:112246884-112246906 ATATTGAAGTCCTAACCTTCAGG + Intergenic
1074654570 10:115570361-115570383 ATGCTGAAATCTTAACCCCCAGG - Intronic
1075132893 10:119755508-119755530 ATGCTGAAGTCCTAACTCCCAGG - Intronic
1075220775 10:120582539-120582561 ATGCTGAAGTCCTAGTCCCTAGG - Intronic
1075432372 10:122398568-122398590 ATGCTGAGGTGCTAACCCTATGG + Intronic
1075473536 10:122712445-122712467 ATGTTGAAATCATAACCCTCAGG + Intergenic
1075663179 10:124212410-124212432 ATGTTGAAGGCCTGATCCCAGGG - Intergenic
1075786183 10:125051746-125051768 ATGTTAAAGTTCTAAGCCCCAGG + Intronic
1076274269 10:129183247-129183269 ATGTTGGAGTCCTAACTCCCAGG - Intergenic
1076427381 10:130377186-130377208 ATGTCCAAGTCCTAACTCCCAGG + Intergenic
1076623708 10:131809015-131809037 GTGTCCAAGTCCTAACCCCCAGG - Intergenic
1076817383 10:132921582-132921604 GTGTTGAAGTCCTCGCCCCCAGG + Intronic
1076822186 10:132944911-132944933 ATGCTGGAGTCCTAGTCCCACGG - Intergenic
1077212309 11:1377097-1377119 AGGTTAAAGTCCTAGCCCCCAGG + Intergenic
1078867698 11:15313156-15313178 ATGTTGAAACCCAACCCCCAAGG + Intergenic
1079503136 11:21125023-21125045 ATGTTAAAATCTTAACCCCTAGG - Intronic
1079992849 11:27265096-27265118 GTGTTGAACTCCTGACCTCAAGG - Intergenic
1080063301 11:27980695-27980717 GTGTTGAAGTCCTAACCTTCAGG - Intergenic
1080240183 11:30118724-30118746 ATGTTGAAGCCCTGACTCCCAGG - Intergenic
1080657456 11:34268972-34268994 ATGTTGAAGTCTTAACCCCTAGG - Intronic
1080738973 11:35046163-35046185 ATCTTGAACTCCTGACCTCAAGG - Intergenic
1080796940 11:35573614-35573636 ATGTTGCAATCCTCACCCAAAGG + Intergenic
1080878628 11:36299019-36299041 ATGATGAAGCCCTAACCCCCAGG - Intronic
1080881157 11:36322019-36322041 ATGTTGAAGTCCTAAGTCCCAGG - Intronic
1081312280 11:41588518-41588540 TTGTTGAGGTCCTAACACCCAGG - Intergenic
1081486212 11:43531599-43531621 AAGTTCAAGTCCTAGCCCCCAGG + Intergenic
1081754780 11:45536781-45536803 ATGTCCAAGTCCTGACCCCCAGG - Intergenic
1081808783 11:45903841-45903863 CTGTTGCAGTACTAACCCCAGGG - Intronic
1082215499 11:49562374-49562396 ATTTTCAAGTCCTAAACCAATGG - Intergenic
1083082645 11:60109905-60109927 ATGTTGAAGTCCTAAGCGCCAGG + Intergenic
1084483769 11:69436541-69436563 GTGTTGAAGTCTTAACCCCCAGG + Intergenic
1084491819 11:69483014-69483036 ATGTTGAAGTCTTAACTCCCAGG - Intergenic
1084538105 11:69769686-69769708 ATGTTGAAGTCCTAACCCCTAGG - Intergenic
1084743973 11:71155862-71155884 ATGTGGAAGTCCGAATCCCCGGG + Intronic
1085606958 11:77909572-77909594 ATACTGCAATCCTAACCCCAAGG - Intronic
1086051848 11:82601376-82601398 ATGTTGAAATCCTAACTCCAAGG - Intergenic
1086111700 11:83206474-83206496 ATGTTGAAATCTTAACCCCAAGG + Intronic
1086128770 11:83378826-83378848 ATGTTGGAGTCCTAACCCCCAGG - Intergenic
1086320218 11:85638299-85638321 ATTTTGAAATACTAACCCCAAGG - Intergenic
1086634073 11:89062106-89062128 ATTTTCAAGTCCTAAACCAATGG + Intronic
1087617565 11:100505962-100505984 ATGTTGAAGCTCTAACCTCCAGG + Intergenic
1088372849 11:109110545-109110567 ATGTTAAAGTCCTAGCCCCCAGG + Intergenic
1088450793 11:109979198-109979220 GTGTTGAACTCCTGACCTCAAGG - Intergenic
1088824010 11:113478451-113478473 ATGTTGAAATCCTAAGCCCCAGG - Intergenic
1089546872 11:119234221-119234243 GTGTTGAACTCCTGACCTCAGGG + Intronic
1089790714 11:120941509-120941531 ATGTTGAATTTCTAACCTCTAGG + Intronic
1090533228 11:127612873-127612895 ATGTTGAAATGCAATCCCCAAGG - Intergenic
1090731961 11:129580148-129580170 ATGTTGAAGCCCAGCCCCCAAGG + Intergenic
1091318352 11:134632062-134632084 AGGTGGAAACCCTAACCCCAGGG - Intergenic
1092475307 12:8813846-8813868 ATGTTGAAGTCCTAACTCCTAGG - Intergenic
1092730071 12:11523015-11523037 ATGTTGAAATTCAACCCCCAAGG + Intergenic
1092946112 12:13455825-13455847 ATGCTCAAGTCCTAACCCCCAGG + Intergenic
1092983242 12:13819006-13819028 ATGTTGAAGGCCTAACCACTAGG + Intronic
1093520764 12:20047378-20047400 ATGTGGAAATCCTAAATCCAAGG - Intergenic
1094182947 12:27611520-27611542 ATGTTGAAATCCTAAGCCCCAGG - Intronic
1094212657 12:27908815-27908837 ATGTTGAAATCCTGAACCCAAGG - Intergenic
1094592969 12:31838367-31838389 ATGTTGAAATCCTAACTGCCAGG - Intergenic
1094642809 12:32292446-32292468 ATGTTGAAGTCCTAACTCCCAGG - Intronic
1095251678 12:39986227-39986249 ATATTGAAATCCTAACCCCAAGG - Intronic
1097724797 12:63063128-63063150 ATGTTGAAATCCTCACCCCAAGG - Intergenic
1098111178 12:67123303-67123325 AAGTCGAAATTCTAACCCCAAGG - Intergenic
1098280340 12:68855946-68855968 GTTTTGAACTCCTAACCTCAGGG + Exonic
1098451614 12:70624743-70624765 TTGTTTTTGTCCTAACCCCACGG - Intronic
1098665782 12:73161578-73161600 ATGTTGAACTCCTAAACCTCTGG + Intergenic
1098880065 12:75907944-75907966 ATGTTGAAGTCCTGATTCCCAGG - Intergenic
1098884471 12:75946244-75946266 ATCTTGAACTCCTGACCTCAAGG - Intergenic
1099219017 12:79890006-79890028 ATCTTGGATTCCTTACCCCAAGG - Intronic
1099232503 12:80043455-80043477 GTGTTGAAATCTTAACCCCAAGG - Intergenic
1099407266 12:82280251-82280273 ATGATGAAGTTCTAACTCCCAGG + Intronic
1099438468 12:82670977-82670999 CATTTGAAGTCCTAACCCCAAGG + Intergenic
1099802901 12:87479733-87479755 ATGTTGAAATGGTAACACCATGG - Intergenic
1100121378 12:91372954-91372976 ATGTTGAAATCCTAACCCGTTGG - Intergenic
1100600052 12:96105213-96105235 ATGTTGAAATCCTAACCCCCAGG + Intergenic
1100779669 12:98010555-98010577 ATGTTGAAATCCTAACCCCAAGG + Intergenic
1101546628 12:105719418-105719440 ATGTTGAACCATTAACCCCAAGG - Intergenic
1101803350 12:108042046-108042068 ATGTTGAAATTTGAACCCCAAGG - Intergenic
1101805171 12:108057207-108057229 ATGTTGAAGTCCTGACCCCTAGG - Intergenic
1101818072 12:108161267-108161289 ATGTTTAAGTTCTAACCTCCAGG + Intronic
1101860475 12:108478415-108478437 ATGTCCATGTCCTAACCCCCAGG - Intergenic
1102193570 12:111007893-111007915 ATGTTGAAGCCCTAACCTTGAGG - Intergenic
1102696403 12:114803001-114803023 AGGTTGAAGTCCTAACCCCCAGG - Intergenic
1103022260 12:117544089-117544111 ATGCTAAAGTCCTAACCTCCAGG - Intronic
1103038713 12:117677239-117677261 ATGTTGAAGTCCTAACCCCTAGG + Intronic
1103252769 12:119515219-119515241 ATGCTGAAGTCCTAATCACCAGG - Intronic
1103867183 12:124062539-124062561 ATCTTGATGTCCTACCCCTACGG - Intronic
1104022996 12:125006183-125006205 ATGTGGAAGCCCTAAACCCTAGG - Intronic
1104032267 12:125073415-125073437 ATGGTGAACTCCTAATGCCATGG + Intronic
1104073986 12:125373302-125373324 GTGTTGAAGCCCTAACCTCCAGG + Intronic
1104248440 12:127065342-127065364 ATGTCCAAGTCCTAATCCCCAGG - Intergenic
1104287852 12:127441446-127441468 ATCTTGAACTCCTGACCTCAAGG - Intergenic
1104655247 12:130569541-130569563 ATGTTGAATTGCAAGCCCCAGGG + Intronic
1104979261 12:132566328-132566350 ATGTTTAAATCCTCACCCCCAGG - Intronic
1105323767 13:19351871-19351893 ATCCTGAAGTCCTAACTCCCAGG - Intergenic
1105658837 13:22470694-22470716 ATGTTGAAATCCTCACCCCCAGG - Intergenic
1105831577 13:24166904-24166926 ATGTTGAAATTTAAACCCCAAGG - Intronic
1105870190 13:24497667-24497689 ATGCTGAAGTCCTAACTCCCAGG + Intronic
1105930057 13:25044014-25044036 ATGGTGAAGTCCTAACCCCAGGG + Intergenic
1106328917 13:28720630-28720652 ATCTTGAACTCCTGACCTCAGGG + Intergenic
1106531768 13:30599814-30599836 AGGTTGAAGCCCTAATCCCCTGG - Intronic
1106844780 13:33726570-33726592 GTGTTGAAGCACTAACCCTAGGG - Intergenic
1106889052 13:34223362-34223384 ATGTTGAAGTCCTAACACCTAGG + Intergenic
1107013973 13:35694550-35694572 ATGCTAGAGTCCTAACCCCCAGG + Intergenic
1107196822 13:37662089-37662111 GTCTTGAACTCCTAACCTCAAGG - Intronic
1107414072 13:40184751-40184773 ATATTGAAATCCTAACCCCCAGG - Intergenic
1107817630 13:44258379-44258401 ATGTTGAAATCTTATCACCAAGG + Intergenic
1107876499 13:44795623-44795645 ATTTTGAAATCCTTACCCCCAGG + Intergenic
1108070640 13:46625354-46625376 ATGTTGAAATCCTGGCCCCCAGG + Intronic
1108124725 13:47229620-47229642 ATGTTAAAGTCCTAATGCCCAGG + Intergenic
1108207658 13:48106989-48107011 ATGTTGAAGCCCTAAGTCCCAGG + Intergenic
1108701252 13:52946153-52946175 GTGTTTGAGTCCTAACCCCTAGG - Intergenic
1109120329 13:58448270-58448292 ACGTCAAAGTCCTAACCCCCAGG - Intergenic
1109157673 13:58930936-58930958 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1109233506 13:59787775-59787797 ATGTTGAAATCCTAATTCCAAGG + Intronic
1109622744 13:64930244-64930266 AAGTTGAAATCCTAACCCCCAGG - Intergenic
1109977763 13:69862622-69862644 ATGTTGAAGCGTTAACCTCAAGG + Intronic
1110266446 13:73542996-73543018 ATCTTGAGGTCCTTAGCCCAAGG - Intergenic
1110525535 13:76532192-76532214 ATGTTGAAGTCTTAAATCCCAGG - Intergenic
1110544149 13:76737635-76737657 GTGTTGAAGTCCTAATCCCCAGG + Intergenic
1111963053 13:94832900-94832922 ATGTTGAAGTTCTAACCCCCAGG + Intergenic
1112123675 13:96440944-96440966 ATGTTGAAACCCTAACCCCATGG + Intronic
1112354996 13:98666847-98666869 ATCTTGAACTCCTGACCTCAGGG - Intergenic
1112740792 13:102471165-102471187 ATGTTGAAGTCATATTCTCATGG + Intergenic
1113398968 13:109974136-109974158 GTGCTGAAGTCCTAAACCCCAGG + Intergenic
1113399513 13:109978060-109978082 ATGTTGAAGTCCTAATCTCCAGG - Intergenic
1113415971 13:110129050-110129072 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1113458133 13:110463417-110463439 ATGCTGAAGTCTTAACCCCCAGG - Intronic
1113565628 13:111318023-111318045 ATGTTGAAGTCCTAACCCCTAGG - Intronic
1114444728 14:22779670-22779692 ATCTTGAACTCCTGACCTCATGG + Intronic
1114838335 14:26231896-26231918 ATGTTGAAATACTAACCTCAAGG + Intergenic
1114944159 14:27657255-27657277 ATGTGGAAGTCCTAACTCCCAGG + Intergenic
1115171445 14:30512310-30512332 ATGTTGAAATCCTAACCCAAAGG - Intergenic
1115658542 14:35467209-35467231 ATGTTGAACTCCTACCCCCAAGG - Intergenic
1115939562 14:38593067-38593089 GTGTTGAAGCCCTAACCCTAGGG + Intergenic
1115952511 14:38737191-38737213 ATGTTGAAATCCTAACCCACAGG + Intergenic
1115996474 14:39200885-39200907 ATGTTGAAATCCTAGCCCCCAGG - Intergenic
1116869419 14:50057249-50057271 ATGTTGAAGTCCTAATCCTCAGG + Intergenic
1117352404 14:54894141-54894163 ATGTTGAAGTCCTAAACCCCAGG + Intronic
1117666721 14:58063372-58063394 ACGTTGAAGTCCTAACCCTGGGG - Intronic
1117772816 14:59151777-59151799 ATGTTGGAGTCCTAATCCCCAGG - Intergenic
1117775549 14:59180672-59180694 ATGCTGAAGTCTTAATCCCCAGG + Intergenic
1117964806 14:61195907-61195929 ATGCCGAAGCCCTAACCCCCAGG - Intronic
1118068269 14:62216320-62216342 ATGTTGAAATCTAACCCCCAGGG + Intergenic
1118097582 14:62555923-62555945 ATGTTGAAATCCCAACCCTAAGG + Intergenic
1118801770 14:69196317-69196339 ATGTTGAAGGTCTAACCCCCAGG - Intronic
1119112040 14:71983809-71983831 ATTTTGTAGTCCTAAACCCTGGG - Intronic
1119134542 14:72204773-72204795 ATGTTGAAATCCTAACCCCTAGG - Intronic
1119665132 14:76480083-76480105 ATCTTGAACTCCTGACCTCAAGG + Intronic
1119689769 14:76662441-76662463 GTTTTGAATTCCTAACCTCAAGG - Intergenic
1119715809 14:76858513-76858535 ATGTTGGAGTTCTAACCCCTAGG - Intronic
1119750563 14:77074665-77074687 ATGTTGCAGCCCTAACCCCCAGG - Intergenic
1120713597 14:87817703-87817725 ATATTAAAATCCTAACCCCTAGG + Intergenic
1121567726 14:94923303-94923325 ATGCCGAAGTCCTAACCCTCAGG - Intergenic
1121853193 14:97242505-97242527 ATGTTAAAATCCTAGCCCCCAGG - Intergenic
1121911119 14:97793407-97793429 ATGTTGAAGACCTAACCCTCAGG - Intergenic
1122008539 14:98726673-98726695 ATGTTGAAGACTTAAGCCCCAGG - Intergenic
1122161545 14:99787934-99787956 CTGTTGAAGTCCTAATGCCCAGG - Intronic
1122410047 14:101521272-101521294 ATGTTCAAGTTCTACCCCCAGGG + Intergenic
1122437660 14:101710893-101710915 GTGTTGAAATCCTAACTCCCAGG + Intergenic
1122909809 14:104821965-104821987 ATGTTGAAGGCCTAACCCCCAGG - Intergenic
1123002763 14:105305005-105305027 ATGTTGACGTCCTTGCCCCAAGG + Exonic
1123068950 14:105631829-105631851 GTGTTGAAGTCCTAACCCCCAGG - Intergenic
1123073107 14:105651787-105651809 GTGTTGAAGTCCTAACCCCCAGG - Intergenic
1123093027 14:105750557-105750579 GTGTTGAAGTCCTAACCCCCAGG - Intergenic
1123098500 14:105777654-105777676 GTGTTGAAGTCCTAACCCCCAGG - Intergenic
1123107438 14:105849202-105849224 GTGTCGAAGTCCTAACCCCCAGG + Intergenic
1123708187 15:22965939-22965961 GTGTTGAAGCCTTAACCCCCAGG + Intronic
1123813406 15:23952367-23952389 TTGTAGATGTCCTATCCCCAAGG - Intergenic
1124023059 15:25941300-25941322 ATGTTGAAGCCCCGACCCCCAGG - Intergenic
1124206408 15:27724518-27724540 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
1124212398 15:27774628-27774650 ATGTTGAAGCCCTAGCCCCCAGG + Intronic
1124463236 15:29912263-29912285 ATGTTGAAATCCTAACTCCCCGG - Intronic
1124841904 15:33249961-33249983 ATGTTAAGCTCCTAACACCATGG + Intergenic
1125618997 15:41042229-41042251 GTCTTGAATTCCTAACCTCAAGG + Intronic
1126010271 15:44295841-44295863 ATGTTGAAGTCCCAGCCTCCAGG - Intronic
1126120204 15:45244852-45244874 ATCTTGAACTCCTGACCTCAAGG - Intergenic
1126344130 15:47675248-47675270 ATGTTGAAGCCCTAATCCCTAGG + Intronic
1126360671 15:47842667-47842689 GGGTTGAAATCCTAAGCCCAAGG + Intergenic
1126401544 15:48276360-48276382 ATGTTGAAGTGCTAACCCCCAGG + Intronic
1126591042 15:50339998-50340020 ATGTTGAAATCCTAACCCCAAGG + Intronic
1127638689 15:60894802-60894824 TTAATGAAGTCCTAACACCAGGG - Intronic
1127798414 15:62457398-62457420 ATGCTGAAGCCCTAAACCCAAGG - Intronic
1127818521 15:62634108-62634130 ATGTTAAGGTCCTAACCCCCAGG - Intronic
1128618197 15:69126797-69126819 ATGTCCATGTCCTAACCCCCAGG + Intergenic
1128645447 15:69375406-69375428 AAGTTAAAGTCCTAACCTCCAGG - Intronic
1128904193 15:71452547-71452569 ATGTTAAAGCCCTAACCCCAAGG + Intronic
1130125819 15:81093512-81093534 GTCTTGAACTCCTAACCTCAGGG - Intronic
1130226804 15:82065249-82065271 GTCTTGAACTCCTAACCTCAAGG - Intergenic
1130606152 15:85318871-85318893 ATGTTGAGCTCCAAACCCCAAGG - Intergenic
1130687470 15:86051441-86051463 ATGTTGAAATCCTAACTCCCAGG - Intergenic
1131036548 15:89226186-89226208 ATGTGGAAGCTCTAACCCCCAGG + Intergenic
1131345194 15:91640286-91640308 ATGTTGAAATCCTAACTCCAAGG - Intergenic
1131393459 15:92068057-92068079 ATGTTGAAATCCTAATACCCAGG - Intronic
1131443354 15:92475493-92475515 AGGTTGAAATCCTAGCCCCCAGG - Intronic
1131476795 15:92746796-92746818 GTGTTGAACTCCTGACCTCAGGG - Intronic
1131986580 15:98047966-98047988 AAGTTGAAGTTGTAACCCCCAGG - Intergenic
1132249597 15:100325279-100325301 ATGTTGAAGTCCTAACCCCCAGG + Intronic
1133041640 16:3064157-3064179 ATGCTGAATTCCTAAGCCCCAGG + Intergenic
1133364203 16:5198034-5198056 ATGTTGAAATCCTAACCCCAAGG - Intergenic
1133385986 16:5370928-5370950 ATGTTGAATCCCTAACCCGCAGG + Intergenic
1133405227 16:5518888-5518910 ATGTTGAGGTTCTAACCCCTGGG + Intergenic
1133418685 16:5626492-5626514 ATGTTAAAGTCCTAACCGCCAGG - Intergenic
1133549504 16:6840491-6840513 GTGTTGAAATTCTAATCCCAAGG + Intronic
1133614522 16:7463596-7463618 ATGGTGAAATCTTAACACCAAGG - Intronic
1133837448 16:9379445-9379467 ATATTGAAGCCCTAACACCCAGG - Intergenic
1134350129 16:13429640-13429662 ATGTTGAATTCCTAAACTCCAGG - Intergenic
1134693592 16:16206917-16206939 ATCTTGAACTCCTGACCTCAGGG - Intronic
1134819711 16:17236927-17236949 AGGTTGAATTCCTAAGCCCCAGG - Intronic
1134978262 16:18587783-18587805 ATCTTGAACTCCTGACCTCAGGG + Intergenic
1135050771 16:19191273-19191295 ATGTTGAAATCCTAACCCCGAGG + Intronic
1135103889 16:19630698-19630720 ATGTTGAAATCCTAGCCCCCAGG + Intronic
1135396454 16:22135486-22135508 ATGTTGAAGTCTGAACCCTCAGG - Intronic
1136290581 16:29269057-29269079 ATGTAGAAGTCCTAACCCCCAGG - Intergenic
1136501561 16:30672664-30672686 ATCTTGAACTCCTGACCTCAGGG - Intergenic
1137527849 16:49251819-49251841 ATGTCCAAGTCCTAACCCCTAGG - Intergenic
1137753219 16:50881835-50881857 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
1137971191 16:52986710-52986732 GTGTTGAAGTTCTAACCCCCAGG - Intergenic
1138343463 16:56305977-56305999 AGGTTGAAGTTCTAACCCCCAGG - Intronic
1138694894 16:58803902-58803924 ATGGTGGAGTCCTAACTCCAAGG - Intergenic
1139148631 16:64352594-64352616 ATGTTCAAATTCTAACCTCAAGG + Intergenic
1139309491 16:66016407-66016429 ATGTCCATGTCCTAACCCCTGGG - Intergenic
1140393756 16:74609931-74609953 ATCTTGAATTCCTGACCTCAAGG + Intergenic
1141051477 16:80768642-80768664 ATGTTGAAATCCTACCCAAAGGG - Intronic
1141290516 16:82714291-82714313 ATGTTGAAGTCCAAATCCCCAGG + Intronic
1141731370 16:85825219-85825241 TTGTTGAAGTCCTGAGCCAATGG - Intergenic
1141821217 16:86447338-86447360 ATGTTGGAGCCCTAACTCCTAGG - Intergenic
1142096461 16:88242577-88242599 ATGTAGAAGTCCTAACCCCCAGG - Intergenic
1143041951 17:4044934-4044956 GTGTTGAACTCCTGACCTCAAGG - Intronic
1143327256 17:6107556-6107578 ATGTTGAAGTCCTAACCCCAGGG - Intronic
1143691188 17:8567500-8567522 GTGTTGAAGTCCTAACCCCCAGG + Intronic
1144344042 17:14333975-14333997 GTCTTGAACTCCTAACCTCAAGG + Intronic
1146551601 17:33785027-33785049 ATGTTGAAGTCCTAACTCCCAGG + Intronic
1146810715 17:35900822-35900844 ATGATGAAGAACTACCCCCAGGG + Intergenic
1146840019 17:36145008-36145030 AAGATGAAATCCTAACCCCCAGG - Intergenic
1147259571 17:39201035-39201057 GTTTTGAAGTCTTAAACCCAAGG + Intronic
1147764901 17:42827858-42827880 ATGTTGAAGTCCTAACATCTGGG + Intronic
1148513433 17:48193258-48193280 GTCTTGAACTCCTGACCCCAGGG + Intronic
1149439830 17:56664781-56664803 GTGTTGAAATCCTAAACCCCAGG - Intergenic
1149549404 17:57528835-57528857 TAGTTGAAGTCCTAACCCCCAGG - Intronic
1150206007 17:63408153-63408175 ATAATGAGGTCCTAACCCAAGGG + Intronic
1150650944 17:67009850-67009872 ATGCTGAACTCCTAACCCTGAGG - Intronic
1151152490 17:72099813-72099835 ATGTTGAAGACCTGACCTCCAGG - Intergenic
1151184785 17:72355766-72355788 ATGTTGAAATTCTAACCCCAAGG - Intergenic
1151623893 17:75264527-75264549 ATAATGAAGTCCCTACCCCATGG - Intronic
1151909179 17:77070278-77070300 ATGTTGAAGTCCTAACCCTCAGG - Intergenic
1152297297 17:79475512-79475534 ATGTTCCAGCCCTAACCCCCAGG + Intronic
1152317483 17:79589513-79589535 ATGTTGACGTCCTAACCTCCGGG - Intergenic
1152790436 17:82275785-82275807 ATGTTGAATTGTAAACCCCAAGG + Intergenic
1152818014 17:82420161-82420183 ATGTTCAAGTCTTAACCCCTGGG + Intronic
1153216967 18:2829648-2829670 ATCTTGAACTCCTGACCTCATGG + Intergenic
1153512775 18:5873654-5873676 ATGCTGAAGTCCTAACCCCCAGG + Intergenic
1153706143 18:7747808-7747830 ATGTTGTACTCCTAACCCCTCGG - Intronic
1155091842 18:22519669-22519691 AAGCTGAACTCCTGACCCCAGGG - Intergenic
1155097476 18:22571796-22571818 ATGTTGAAGTCCTAATGGCCAGG - Intergenic
1155337117 18:24776006-24776028 ATGGTGAAGTCCTAGTCCAAAGG + Intergenic
1155487071 18:26356292-26356314 ATGTTGAAATCCTAACACCCAGG - Intronic
1155518159 18:26643342-26643364 ATGTTGAAACCCCACCCCCATGG - Intronic
1155564077 18:27113504-27113526 ATGTTGAAATCCTAACCCCAAGG + Intronic
1155603162 18:27572647-27572669 ATGTTGAAACCCTAACCCCAAGG - Intergenic
1156022658 18:32617548-32617570 ATGTTGAAGTCCTAATCCCCTGG - Intergenic
1156172428 18:34502022-34502044 ATGTTGAAGTCCTAGCCCCCAGG - Intronic
1157330592 18:46701074-46701096 ATGCTTAGGTCCTAACCCCCAGG + Intronic
1157423298 18:47563868-47563890 ATGTTGAAATCTAAGCCCCAAGG + Intergenic
1157820101 18:50760865-50760887 ATGTTGAAATCTAATCCCCAAGG + Intergenic
1158149763 18:54355415-54355437 ATGTTGAAATCCTAACTCCCAGG + Intronic
1158274652 18:55754329-55754351 ATGTTGAAGTCCTAACACTCAGG + Intergenic
1158453963 18:57590679-57590701 ATGTTGACATCCTAGCCCCCAGG - Intergenic
1158617835 18:59004416-59004438 ATGTTGAAACCATAACCCCCTGG + Intergenic
1158681816 18:59574860-59574882 ATGTGGAAGTCCTAACCCCCAGG + Intronic
1159005016 18:63003777-63003799 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
1159007619 18:63026511-63026533 ATGTTGACATCCTAACCCCCAGG + Intergenic
1159374085 18:67568462-67568484 ATGCTCAAGTCCTAAACCCCAGG - Intergenic
1159440188 18:68468739-68468761 ATGTTGTAGTCTTAACTTCATGG - Intergenic
1160064942 18:75565838-75565860 ATGTTAAAGTCCCACCCCCAGGG - Intergenic
1161260270 19:3333860-3333882 ATGGTGAAGTCCTAACACCCAGG - Intergenic
1161541917 19:4857071-4857093 ATGTTGAAGTCCTGATCCCCAGG + Intronic
1161629939 19:5348814-5348836 ATGTTGAAGTCCTAACCCCTAGG - Intergenic
1161670519 19:5605649-5605671 AAGTGGAAGTCCTTTCCCCATGG - Intronic
1161748243 19:6074915-6074937 ATGCTGAACTCCTCACCCCAAGG + Intronic
1161757350 19:6143880-6143902 TTGTGGAAGTCCTAACCCCCAGG + Intronic
1162041877 19:7975676-7975698 ATGCCGAAGTCCTAACCCCTTGG + Intronic
1162840726 19:13354683-13354705 ATGTTTAAGTCCTAACCCCCTGG + Intronic
1162844860 19:13384478-13384500 ATCTCGAACTCCTAACCTCAGGG - Intronic
1162970460 19:14178083-14178105 ATGCTGAAGTCCTAACCCCCAGG + Intronic
1163100019 19:15089866-15089888 ATGTTGAAGTCCTAACCCCAAGG + Intergenic
1163764393 19:19154659-19154681 ATCTTGAACTCCTGACCTCAAGG + Intronic
1166168775 19:41012165-41012187 ATCTTGAACTCCTGACCTCAAGG + Intronic
1166648686 19:44553357-44553379 ATCTTGAACTCCTAGCCTCATGG + Intergenic
1166880028 19:45923317-45923339 ATGTTGAAGCCCTAACACCTAGG + Intergenic
1167188770 19:47967731-47967753 ATGTTGAAGCCCCAACCCCCAGG - Intergenic
1167316353 19:48765432-48765454 GTCTTGAACTCCTAACCTCAGGG - Intergenic
1168003578 19:53468074-53468096 TTTTTGAAGTCCTCACCCAAGGG + Intronic
1168280675 19:55303862-55303884 ATCTTGAACTCCTAGACCCAGGG - Intronic
1168523158 19:57068739-57068761 ATATTGAAGTCCTCGCCCCCAGG - Intergenic
1202642822 1_KI270706v1_random:111554-111576 ATCTTGAACTCCTGACCTCAGGG + Intergenic
925183542 2:1832082-1832104 GTGTTGAAGCCCTAACCCCTGGG + Intronic
925304951 2:2841651-2841673 ATGTTAAAATCCTAACCCCAAGG + Intergenic
925409925 2:3634089-3634111 CTGTTGAAGCCGTGACCCCAAGG - Intronic
925516193 2:4684889-4684911 AAGTTTAAGTCCTAATCCCTGGG + Intergenic
925594597 2:5543011-5543033 ATGTTGAAGCCCTTACCCTCAGG + Intergenic
925670386 2:6304277-6304299 ATATTGAAACCCTAACCCCCAGG - Intergenic
925719017 2:6810415-6810437 ATGTAGAAGCCCTAGCCCCTAGG - Intergenic
926055970 2:9774246-9774268 ATGTTGACATTCTAACCCCCTGG - Intergenic
926394220 2:12424584-12424606 ATGTTGAAGTCCCAAGCTCTAGG - Intergenic
926746314 2:16161277-16161299 ATGTTGAAGCCCCAAACCCCAGG + Intergenic
926888255 2:17617275-17617297 ATCTTGAACTCCTGACCTCAGGG - Intronic
927087795 2:19688554-19688576 ATGTAGAAATTCTAACCCCCAGG + Intergenic
927499480 2:23573023-23573045 ATGATGAAGACGTAACCCCGTGG + Intronic
928068490 2:28190789-28190811 ATGTTGAAATCCTAACCCTCAGG - Intronic
928191138 2:29169513-29169535 ATGCTGAAGTCCTAACCTCCTGG - Intronic
929195631 2:39181549-39181571 ATGTTGAAGTTCTAACTCCCAGG + Intronic
929296060 2:40248300-40248322 AGGTTGAAATCCTAACTCCCAGG + Intronic
929348490 2:40917700-40917722 AGGTTGAAAACCTAAGCCCAAGG - Intergenic
930106572 2:47645039-47645061 ATGTTGAAGCCCTAACCCCCAGG - Intergenic
930420414 2:51145588-51145610 ATGTTGAAGTCCTAATGCAATGG - Intergenic
930603503 2:53468943-53468965 GTGTTGAAGCCCTAACACCCAGG - Intergenic
930694082 2:54393707-54393729 ATCTTGAACTCCTGACCTCAGGG + Intergenic
930764430 2:55070339-55070361 ATGTTGAACTCCTGAGCTCACGG - Intronic
930932366 2:56902462-56902484 GTCTTGAACTCCTAACCTCAGGG - Intergenic
930976550 2:57469154-57469176 ATGTTGAAATCCTACCCTCAAGG - Intergenic
931047815 2:58376150-58376172 ATGTTGAAATCCTAACCCTCAGG - Intergenic
931369604 2:61650005-61650027 ATGTCGAACTCCTGACCTCAAGG - Intergenic
931377086 2:61717452-61717474 ATGTTGAAACCCCAACCCCCAGG - Intergenic
932504258 2:72213655-72213677 ATGATGAAATCCTAGCTCCAAGG + Intronic
932571667 2:72941538-72941560 ATGCCCAAGTCCTAGCCCCAAGG + Intergenic
932634443 2:73376083-73376105 ATGTTGAAATCCTAACTCCAAGG + Intergenic
933057411 2:77689524-77689546 ATGTTGCAATTCTAACCCCAGGG + Intergenic
933927549 2:87110714-87110736 ATGTTGCAATTCTAACCCCAGGG + Intergenic
934049488 2:88198452-88198474 ATGATGCAGTCCTAACCCCCAGG + Intergenic
934054357 2:88239624-88239646 ACATTGAAGCCCTAACCCCCAGG - Intergenic
935285489 2:101560566-101560588 TTGTTGAAGTCCTAACCCCCAGG + Intergenic
935485371 2:103646817-103646839 ATGTTCATGTCCTAATCCCCAGG + Intergenic
935598458 2:104898018-104898040 ATGTTGAAATCAAATCCCCAAGG + Intergenic
935628982 2:105196455-105196477 ATGTTGAAATCCTAACCCCAAGG - Intergenic
935733887 2:106090488-106090510 ATGTTGAAGTCTTAACCCATAGG - Intergenic
936119748 2:109731165-109731187 ATGTTGAAATCCTAAACCCCAGG - Intergenic
936283294 2:111161194-111161216 CTGTTGCAGTCCTAACCCCCCGG - Intronic
937131551 2:119517874-119517896 ATGTTGAAGCCCTACCCCCAGGG + Intronic
937476121 2:122216953-122216975 ATGTTGAAATCCTAGTTCCAAGG + Intergenic
937494158 2:122400374-122400396 ATGTTGAAATCCTCACCCTAAGG + Intergenic
938084128 2:128387093-128387115 ATGTTGAAGTACTAACCCCCAGG - Intergenic
938208769 2:129446693-129446715 ATGTTGAAATCTAACCCCCATGG - Intergenic
938227508 2:129628479-129628501 ATGTTGAAATGCAATCCCCAGGG + Intergenic
938231743 2:129667625-129667647 ATGCTGAAGTCTTAATCCCCAGG + Intergenic
938241342 2:129744566-129744588 ATGTTGAAATCTAACCCCCAGGG - Intergenic
939032320 2:137091791-137091813 ATGTTGAAGTCATAACCCCTGGG - Intronic
939105757 2:137946751-137946773 ATGTTGAAACCTTAGCCCCAAGG + Intergenic
939119597 2:138100513-138100535 ATGTTAAAATTCTAACCCCCAGG - Intergenic
939174178 2:138730412-138730434 ATGTTGAAGTCCTAACCTCCAGG - Intronic
939448645 2:142342377-142342399 ATGTTGAAGTCTTAAAACCTAGG + Intergenic
939836691 2:147137674-147137696 ATATTGCAGTCCTAACACCTAGG - Intergenic
940170513 2:150825029-150825051 ATGTTGAAGCCACATCCCCAGGG - Intergenic
940259024 2:151761316-151761338 ATGTTGAAGTCCTAATCTCCAGG + Intergenic
940364576 2:152833628-152833650 ATGTTGAAATTCTAACCCCAAGG - Intergenic
940389416 2:153114313-153114335 ATGTTGAACAACCAACCCCATGG + Intergenic
941836008 2:170021568-170021590 ATGTTGAAGTCCTAACCCCAAGG - Intronic
942489599 2:176476268-176476290 ATGTTGAAATATTAACCCCACGG + Intergenic
942512935 2:176722210-176722232 ATGTTGAAGCCCCAATCCCCAGG + Intergenic
942860044 2:180598454-180598476 ATGTTGAAATCCTAACTCCCAGG - Intergenic
942862293 2:180629547-180629569 ATGTTGAAGTCCTAATCTCAAGG + Intergenic
943444744 2:187970733-187970755 ATCTTGAACTCCTGACCTCAAGG - Intergenic
943642611 2:190375870-190375892 ATGTTGAAATCCTAACCCCCAGG + Intergenic
943674979 2:190707617-190707639 ATATTGAAATCCTAACTCCAAGG + Intergenic
943787985 2:191900112-191900134 GTGTTGAACTCCTGACCTCAGGG + Intergenic
944336525 2:198541402-198541424 AAGTTGAAGTACTAAACCAAAGG - Intronic
944915918 2:204360103-204360125 ATGCTGAAGTCCTAACCCCCAGG + Intergenic
945025488 2:205615892-205615914 ATGGAGAATTCCTAACACCAAGG - Intronic
945069978 2:205979873-205979895 ATGTTGAACTCCTAACCCCCAGG - Intergenic
945364783 2:208938667-208938689 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
945756187 2:213849726-213849748 ATGTTAAAGTCCTTACCATAAGG + Intronic
946041076 2:216783362-216783384 ATATTGAGATCCTAACCCCCAGG - Intergenic
946088970 2:217203637-217203659 ATGCTGAAGTCCTCACCCCCAGG - Intergenic
946096311 2:217277359-217277381 GTGTTAAAATCCTAACCCCCAGG - Intergenic
946447897 2:219755244-219755266 ATGTTAAAATCCTAACCCCAAGG + Intergenic
946449084 2:219764338-219764360 ATGCTGCAGTCCTAAACCCCGGG - Intergenic
946451683 2:219785267-219785289 ATGCTGAAGTCCTATCACCCAGG + Intergenic
946678997 2:222193971-222193993 ATGTTGAAATCCTAATCCCCAGG - Intergenic
947699937 2:232224619-232224641 GTGTCGAACTCCTAACCTCAAGG - Intronic
947801464 2:232930741-232930763 GTGTTGAAATCCTAACTCCCAGG - Intronic
948076287 2:235167613-235167635 ATGTGGCAGTCCTAGCCCCCAGG + Intergenic
948147974 2:235722706-235722728 ACGTTCAAGCCCTAACCCCTGGG - Intronic
948384534 2:237573382-237573404 ATGTTGAAATCTGACCCCCAGGG + Intergenic
948782081 2:240328031-240328053 ATGTTGAAGTCCTAATCCCCAGG - Intergenic
948814678 2:240503754-240503776 AAGTTGAAGTCCTAAACCCCGGG + Intronic
948858000 2:240739428-240739450 ACGTGGAAGTCCTAACCTCCAGG + Intronic
949036785 2:241819110-241819132 ATGTTGAAATATTAACTCCAGGG - Intergenic
1168803250 20:657501-657523 ATGTTGAAATCCCAACCTCCAGG + Intronic
1168864398 20:1073197-1073219 ATGTTGAAGTCCTAATCCCGAGG - Intergenic
1169447899 20:5687763-5687785 ATGTTAAGGTCCCAACCCCTGGG - Intergenic
1170167015 20:13370619-13370641 ATGTTGATGTCCTAAGCCCCGGG + Intergenic
1170552532 20:17489973-17489995 ATGTTGAAGGCCTTACCCCAAGG - Intergenic
1173298845 20:41782700-41782722 GTGTTAAAGTCCTAACCCCCAGG + Intergenic
1173778556 20:45733735-45733757 ATGTTGAAATCCTAACTCCAAGG - Intergenic
1173991464 20:47307050-47307072 ATGTTGATGTTCTAACCCCAAGG + Intronic
1174384351 20:50178260-50178282 ATGTTCAAGTCCTAACCCCTGGG + Intergenic
1174533659 20:51234269-51234291 GTGTTGAAGTCCTAACCCCCAGG - Intergenic
1175371892 20:58497725-58497747 ATGTTGAAGTCCTGACCCCCAGG - Intronic
1176056080 20:63150053-63150075 ATGTTGAAATCCCGACCCCCAGG + Intergenic
1176160394 20:63644662-63644684 GTGTTGAAATCGTAACCCCAAGG + Intronic
1176963413 21:15185600-15185622 ATGTCAAAATCCTAACCCTAAGG + Intergenic
1177001714 21:15621187-15621209 ATGTTGAAGTCCTGACCCCCAGG - Intergenic
1177209252 21:18049829-18049851 GTGTTGAAGTCCTAACCCCCAGG - Intronic
1177338414 21:19763659-19763681 GTGCTGAAATCCTAACCCTAAGG + Intergenic
1177668915 21:24199986-24200008 GTGTTGAAGTTCTAACCCCAGGG + Intergenic
1177877521 21:26651904-26651926 ATGTTGGAGTTCTAACCTCTAGG + Intergenic
1178036298 21:28586935-28586957 ACGTTGAAATCCTAATCCCAAGG - Intergenic
1178044262 21:28676436-28676458 CTGTTGAAGTCCTAACCCCCTGG - Intergenic
1178102622 21:29286364-29286386 ATGTGAAAATCCTAACCCCAAGG - Intronic
1178318675 21:31588335-31588357 ATGTTGAAATCCTAACCCCATGG + Intergenic
1178635243 21:34296731-34296753 ATGCTGAAGTTCTAACCCCCAGG - Intergenic
1178694824 21:34783672-34783694 ATGTTAAAGTCCTAACCCCCAGG - Intergenic
1178725214 21:35045399-35045421 ACATTGAAGTCCTAACCCCAAGG + Intronic
1178807563 21:35852035-35852057 CTGCTGAAATCCTAACCCCCAGG + Intronic
1179112746 21:38461411-38461433 ATGTTGAAGTCCTAACCCCCAGG - Intronic
1179294063 21:40044905-40044927 ATGTTCATGTCCTAACCCCCAGG + Intronic
1179302435 21:40124475-40124497 ATGTTGAAGTCCTAACCCCCAGG + Intronic
1179596806 21:42448449-42448471 ATGTTCATGTCCTAATCCCCGGG - Intergenic
1180055029 21:45353254-45353276 ATGTTGGAGTCCTAACCCCCAGG + Intergenic
1180700205 22:17777444-17777466 AAGTTGAAGCCCTGACCCCCAGG + Intergenic
1180920222 22:19517836-19517858 ATGTTGAAGCCCTTACCCCCAGG - Intronic
1180943878 22:19679121-19679143 TTGTTGAAATTCTAACCCCTAGG + Intergenic
1181677179 22:24463058-24463080 ATTTTGAAGTCCTAATCCCCAGG + Intergenic
1181881145 22:25981197-25981219 AGGTTGAAGTCTTAATCCCCAGG - Intronic
1181980653 22:26763637-26763659 ATGTTAAAGTCCTAATCCCCAGG - Intergenic
1182084410 22:27551423-27551445 ATGATGAGGTCCTAACCTCCAGG + Intergenic
1182275918 22:29188564-29188586 ATGTTGAAGTCCTAACCCCTAGG - Intergenic
1182510273 22:30814771-30814793 ATGTTGAAGTCCAAACCCCCAGG - Intronic
1182881111 22:33734258-33734280 ATGTTGAAGTCCTAACCCCCTGG - Intronic
1182962609 22:34489740-34489762 ATGTTAAAATCCTAACCCCCAGG + Intergenic
1183112440 22:35660226-35660248 AGGGTGAGGTCCTAACCCGATGG + Exonic
1183822097 22:40354651-40354673 GTGGTGAACTCCTAACCTCAAGG - Intronic
1184262196 22:43324864-43324886 ATGTTGAGGTCCCAACCCCCAGG + Intronic
1184406419 22:44303279-44303301 ATGTTGAAGTCCTAACTCCCAGG + Intronic
1184536745 22:45092742-45092764 ATGTTCAAGCCCTAACCCTCAGG + Intergenic
1184657494 22:45949189-45949211 ATGATGAAGCCTTACCCCCAAGG + Intronic
1184873996 22:47261155-47261177 ATGTTAAAATCCTAACCCCAAGG + Intergenic
1184912234 22:47543789-47543811 ATGTTGAGATTCTCACCCCAAGG + Intergenic
1185153943 22:49182188-49182210 CTTGTGAAGTCCTAACCCCAGGG - Intergenic
1185232474 22:49691155-49691177 ATGCTGAAGCCCTAAGCCCCGGG + Intergenic
949169237 3:978980-979002 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
949416438 3:3819742-3819764 ATGTTGAAGTCCCAATCCCAAGG - Intronic
949432379 3:3991632-3991654 ATTTTGAAGCCTTAACCCCAAGG - Intronic
949676233 3:6456465-6456487 ATGTTGAAGTCCTAACTCCCAGG - Intergenic
949787054 3:7753384-7753406 ATGTTGAAATCCTAATTCCCAGG + Intergenic
950155635 3:10719524-10719546 ATGTTGAAATCCTCACCCCCAGG - Intergenic
951522563 3:23622823-23622845 ATGTTGAAATATGAACCCCAAGG - Intergenic
951565702 3:24010773-24010795 GTCTTGAACTCCTAACCTCAAGG - Intergenic
951680543 3:25290172-25290194 ATGTTGAAGACCTATCCCCCAGG + Intronic
951752719 3:26055236-26055258 ATGTTGAAGTCTTCACCCCAAGG - Intergenic
951890491 3:27563680-27563702 ATGTTGAAATCCAACCCCCAAGG - Intergenic
952817647 3:37459552-37459574 ATGTTGAAATCTTCACCCCAAGG - Intronic
952929763 3:38349992-38350014 ATGCTGAAATCCTAACCCCGAGG - Intronic
953290609 3:41657598-41657620 GTCTTGAACTCCTAACCTCATGG - Intronic
953690856 3:45117878-45117900 ATCTTGAACTCCTGACCTCAGGG + Intronic
954547089 3:51446210-51446232 ATCTTGAACTCCTGACCTCAGGG + Intronic
955491237 3:59485251-59485273 ATGTTGAAATCCTAACCCCAAGG + Intergenic
956142768 3:66162309-66162331 ATGTTGAAGTCCTCTCCCCCAGG - Intronic
956280109 3:67547075-67547097 AAGTTGATATCCTAACCCCCAGG + Intronic
956371311 3:68564946-68564968 GTGTTGAAGACCTAGCCCCCAGG - Intergenic
956735683 3:72236273-72236295 ATGTTGAAGTTCCAACCCCCAGG + Intergenic
957244126 3:77696614-77696636 ATGTTGAAATCCTACCCTCCAGG - Intergenic
957587423 3:82149879-82149901 ATGTTAAAATCCTAAACCCCAGG - Intergenic
957657349 3:83097395-83097417 GTGTTAAAGTCCTAATCCCCAGG - Intergenic
957682328 3:83452722-83452744 ATGTGGAAATCCTAACACCTGGG - Intergenic
957683362 3:83469250-83469272 TTGTTGAAGCCCTAACCCTCAGG + Intergenic
957936566 3:86951483-86951505 ATGTTGAAATCTTAGCCCCCAGG - Intronic
958129662 3:89401826-89401848 ATCTTGAACTCCTGACCTCAGGG + Intronic
958674196 3:97245452-97245474 ATGTTGAAGTCACAACCCCTAGG - Intronic
958893162 3:99802486-99802508 ATGTTGAAGTCCTAATCTGCAGG - Intergenic
959036048 3:101365416-101365438 ATCTTGAACTCCTGACCTCAGGG - Intronic
959047679 3:101492510-101492532 ATGTTGAAGCCCCAACTCCCAGG + Intronic
959828185 3:110826832-110826854 ATGTTGAAGTCTAAACCCCTAGG + Intergenic
960238000 3:115307002-115307024 ATCTTGAAGCCCTAACTCCCAGG + Intergenic
960851515 3:122059714-122059736 ATGTTGAAATCCTAACTCCCAGG + Intronic
961560263 3:127723839-127723861 ATGTTGAAGCTCTAACCCCCAGG + Intronic
962256309 3:133872382-133872404 ATGGTGCAGGCCTCACCCCAAGG - Intronic
962607645 3:137045702-137045724 GTGTTGAAATTCTAACCCCAAGG - Intergenic
963262662 3:143208342-143208364 ATGTTGAAATCCTAACCTCCAGG - Intergenic
963646624 3:147923093-147923115 ATGCTGAAATCCTAACTCCAAGG - Intergenic
964026619 3:152081619-152081641 ATGTTGAAGTCACAAGCCCCAGG - Intergenic
964346488 3:155759299-155759321 GTCTTGAACTCCTAACCTCAGGG - Intergenic
964825571 3:160824075-160824097 ATGTTGAACTCCAACCCCCAAGG + Intronic
965441351 3:168719157-168719179 ATGTTGAAATCCTAACCCCCAGG + Intergenic
965449377 3:168818710-168818732 ATGTTGAAATCCTGACTCCCAGG - Intergenic
965702496 3:171472492-171472514 AGGTTGAAATCCTAACCCCTAGG + Intergenic
965733907 3:171800949-171800971 ATGTTGAAATCCTCACCCCAAGG - Intronic
965954695 3:174355536-174355558 ATATTGAAGTTCTAACCCCCAGG + Intergenic
966258808 3:177950730-177950752 ATGTTGAAGCCCTAACCTCCAGG + Intergenic
966387126 3:179410712-179410734 ATGTTGAAGTCTTAAAGCCCAGG - Intronic
966583377 3:181593399-181593421 ATGTTAAAATCTAAACCCCAAGG - Intergenic
966766963 3:183472236-183472258 ATGTTGAATTGCAATCCCCAGGG + Intergenic
967172257 3:186830972-186830994 TTGTTGAAATCCTAACCCCCAGG + Intergenic
967259178 3:187625295-187625317 ATGTTGAAACCCAACCCCCAAGG + Intergenic
967301778 3:188021346-188021368 ATGCTGAAGTTCTAACCCCCAGG + Intergenic
967437701 3:189468850-189468872 ATGTTGAAACCCTAATCCCAAGG - Intergenic
967873065 3:194248310-194248332 TCATTGAAGTCCTAACCCCTGGG - Intergenic
968745673 4:2358738-2358760 ACATTGAAGTCCTAACCCCCAGG + Intronic
968942627 4:3646743-3646765 ATGTTGAAATCCTAGTCCCCAGG + Intergenic
969045284 4:4332059-4332081 ATGTTGAAGTCACAAACCCCAGG + Intergenic
969089439 4:4682676-4682698 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
969180592 4:5437598-5437620 ATGTTCAAGTCCTAACTCCTGGG - Intronic
969182727 4:5454570-5454592 ATGCTAAAGTCCTAGCCCCCAGG - Intronic
969206797 4:5653248-5653270 ATGTTGAAGTCATAACTCCTTGG - Intronic
969286021 4:6202241-6202263 ATGTTGAAGTGCTCACTCCCAGG + Intergenic
969286323 4:6204588-6204610 GTGCTGAAGCCCTAACCCCCAGG + Intergenic
969398269 4:6937445-6937467 ATGTTGAAATCCTAACCCTCAGG - Intronic
969430106 4:7148967-7148989 GTATTGAAGCCCTAACCCCCAGG + Intergenic
969431573 4:7158009-7158031 CTGTTGAAATCCTAGGCCCAAGG + Intergenic
969432882 4:7166249-7166271 GTGTTAAAGTCCTAACACCCAGG + Intergenic
969463197 4:7339713-7339735 ATGTTGAAGTCCTAACCCCCAGG - Intronic
969633072 4:8349751-8349773 ATGTTGAAGCCCTAACCTCCAGG - Intergenic
969722715 4:8901404-8901426 ATGTTGACATCCTAACCCCCAGG - Intergenic
969862233 4:10046659-10046681 ATGTTAAAGTCCTAACCTCCGGG + Intronic
969946760 4:10791122-10791144 ATGTTGAAATCTTAATCCCCAGG - Intergenic
970879696 4:20914286-20914308 ATGTTAAAACCCTAACCCCAAGG + Intronic
970971394 4:21988229-21988251 ATGTTGAAATCCTACCTTCAAGG - Intergenic
971023234 4:22560176-22560198 ATGTTGAAGTCCTAACCTTGAGG - Intergenic
971304327 4:25466676-25466698 ATGTTGGAATCCCATCCCCAAGG - Intergenic
971815408 4:31480977-31480999 ATGTTGATATTCTAACCCCAAGG - Intergenic
972069665 4:35001460-35001482 ATGTTGAAGTCCTATTGACATGG + Intergenic
972227239 4:37027171-37027193 ATGCTGAAATCCTAACCCCCAGG + Intergenic
972242752 4:37210949-37210971 ATGTTGAATTGCAATCCCCAAGG - Intergenic
972381117 4:38521430-38521452 ATGTCCAAGTCCTAACACCTAGG + Intergenic
972465237 4:39349292-39349314 ACGTTGAAGCCCTAACCCTCAGG + Intronic
973729163 4:53806479-53806501 ATGTTGAAGCTCTAACCCCCAGG - Intronic
973791214 4:54379787-54379809 ATGTTTAAGTCCTAACACCCAGG + Intergenic
973805103 4:54518165-54518187 ATGTTGAAGCCCTAACCCTCAGG + Intergenic
973987590 4:56370063-56370085 ATGTTGAAATCCTAACTCTCAGG + Intronic
974754191 4:66182704-66182726 ATGTTGAAATATTAATCCCAAGG + Intergenic
975473962 4:74800572-74800594 ACATTGAAGCCCTAACCCCCAGG - Intergenic
975626095 4:76348521-76348543 ATGTTGAAACCTAAACCCCAAGG - Intronic
976547023 4:86347844-86347866 ATGTTGAAGTCCTAACCCCAAGG - Intronic
976764521 4:88585234-88585256 ATGTTGAAATCCTAACCCCCAGG - Intronic
976832511 4:89331181-89331203 ATGGTAAAGTCCTAACCCCCAGG - Intergenic
977034109 4:91927485-91927507 ATATTGAAATCCTCATCCCAAGG - Intergenic
978085616 4:104649309-104649331 ATCTTGAACTCCTAAGCTCAAGG - Intergenic
978204434 4:106063661-106063683 ATGTTAAAATCTTAACCCCAAGG + Intronic
979228668 4:118321113-118321135 ATATTGGAGTCCTAACACAAAGG + Intronic
980114549 4:128666633-128666655 CTGTTAAAGTCCTGACCCTAAGG - Intergenic
981100923 4:140828489-140828511 ATGTTGGAGTCCTAACTCCCAGG - Intergenic
981497630 4:145411728-145411750 ATGTTGAAGCCCTAGCCTCTAGG + Intergenic
981686507 4:147460584-147460606 ATGTTGAAATTCTCACCCCAAGG + Intergenic
981686615 4:147461898-147461920 ATATTGTATTCCTAACCCCCAGG + Intergenic
981917557 4:150051550-150051572 ATGTTGAAATTCTATCCCCAAGG + Intergenic
981927790 4:150158358-150158380 ATGTTGAAGCCCTACCCTCTAGG - Intronic
981954290 4:150450646-150450668 ATGTTAAAGTCCTAACCTCCAGG - Intronic
983021460 4:162681135-162681157 ATGTTGAAATCCTAACCTGCAGG - Intergenic
983025319 4:162729098-162729120 ATGCTGAAATCTTAACCCCAAGG - Intergenic
983270193 4:165552009-165552031 ATGTTGTAATCCTAACCCCAAGG - Intergenic
983748704 4:171235347-171235369 ATGTTGAAGCCCTAACACCCAGG - Intergenic
984490880 4:180433133-180433155 ATGTTGAAGTCCTGACCTCAGGG + Intergenic
985316546 4:188663992-188664014 ATGCTGAAGTCCGAATCCCCAGG - Intergenic
985698592 5:1357346-1357368 ATGTTCAAGTCCTGACCCCCAGG - Intergenic
985724421 5:1508326-1508348 CTGTTGATGTCCTGACCCCCAGG + Intronic
985800413 5:2002136-2002158 ACATTGAAGTCCTAACCCCAAGG - Intergenic
986279321 5:6310759-6310781 GTGTTGAAGTCTTGACTCCAAGG + Intergenic
986348480 5:6855832-6855854 ATGTTGAAGCCCAGTCCCCAAGG - Intergenic
986448105 5:7840690-7840712 ATGTTGAAGTCCTAATCCCCAGG + Intronic
986632258 5:9784942-9784964 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
986679203 5:10218190-10218212 ATGCTGAAGTCTTAACTCCCAGG + Intergenic
986945711 5:13016617-13016639 ATGATGAAATCTTAACCCCCAGG - Intergenic
987012688 5:13783231-13783253 ATACTGAAGTTCTCACCCCAGGG - Intronic
987102954 5:14608516-14608538 ATGTTGAAACCCTAATCCCAGGG - Intronic
987173253 5:15280776-15280798 ATGTTTAACTCCTCTCCCCATGG - Intergenic
987213765 5:15711508-15711530 ATGTTGAAGTCCTAACTCGCAGG - Intronic
987223142 5:15811557-15811579 ATGTTAAAGTCCTATCCCCCAGG - Intronic
987507237 5:18789465-18789487 ATGTTGAAGTCCTAACCCTCAGG + Intergenic
987635371 5:20532961-20532983 ATGCTGAAGTCCTCTCCCCCAGG + Intronic
987957989 5:24764863-24764885 ATGTTGAAGTCCTAACCTCCAGG + Intergenic
988047292 5:25972868-25972890 ATCTTGAACTCCTGACCTCAGGG - Intergenic
988606122 5:32679813-32679835 ATGTTGAAGGCTAACCCCCAGGG - Intergenic
988707669 5:33741506-33741528 ATGTTGAAGCCCTGACCCCCAGG - Intronic
988785182 5:34560135-34560157 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
988862457 5:35297745-35297767 ATGTTGAAGTCCTAACCTCCAGG - Intergenic
989978824 5:50617109-50617131 ATATTGAAATCCTAACCCCCAGG + Intergenic
990332179 5:54739076-54739098 AAGTTCAGGTCCTAACCCCCAGG + Intergenic
990491262 5:56305109-56305131 ATGTTGAAGCCCCCACCCCCAGG - Intergenic
990746925 5:58967953-58967975 GTGTTGAAATGCTAACCCCTAGG - Intergenic
990971472 5:61511478-61511500 ATGTTGAAATTCTAACCCCAAGG + Intronic
991202913 5:64014922-64014944 ATGTTGAAATCCTAACCCCCAGG - Intergenic
991392963 5:66168578-66168600 ATCTTGAAATCCTGACCTCAAGG + Intronic
991492254 5:67194839-67194861 ATGTTGAAGTCCTAACCCACAGG + Intronic
992194467 5:74325707-74325729 GTGGTGAAGTCCTAACCCCCAGG - Intergenic
992212798 5:74497040-74497062 AGGTTGAAATCCTAACCCCAAGG + Intergenic
992461282 5:76962559-76962581 GTCTTGAACTCCTAACCTCAAGG - Intronic
992706902 5:79405065-79405087 ATATTGAAGTTCTAACTCCCAGG + Intronic
993575549 5:89595229-89595251 ATGACAAAGTCCTTACCCCAAGG - Intergenic
993776125 5:91999189-91999211 ATGTTGAATTCCTAACCCCTAGG + Intergenic
994361965 5:98861937-98861959 GTGTTGAACTCCTGACCTCAAGG - Intronic
995268984 5:110199531-110199553 ATGTTGAATTCTTAACCCCAAGG + Intergenic
995712576 5:115050146-115050168 ATGTTAAAATGCTAACCCCAGGG - Intergenic
996083237 5:119277990-119278012 ATGTTGAAACCTAAACCCCAAGG - Intronic
996226616 5:121007113-121007135 ATGTTAACATCCTAAGCCCAAGG - Intergenic
996283796 5:121764943-121764965 GTGTTGAAGTCCTAATTCCCAGG + Intergenic
998585495 5:143422472-143422494 CTGTTGAAATCCTAACCCCATGG + Intronic
998652810 5:144140645-144140667 ATGTTGTAGTCCTAATCCCCAGG + Intergenic
998655784 5:144177775-144177797 ATATTGAAGTCCTTACTCCCAGG - Intronic
999895600 5:156030227-156030249 ATGTTGAAGTCCTATCCTGTAGG + Intronic
1000635771 5:163641912-163641934 ATATTGAAGCCCTAACCTCATGG - Intergenic
1000707909 5:164534397-164534419 GTCTTGAAGTCCTGACCTCAAGG - Intergenic
1000991325 5:167914985-167915007 ATGTTGATGTCCTAACCCCTAGG - Intronic
1001029137 5:168248899-168248921 ATCTTGAACTCCTGACCTCAAGG - Intronic
1001171876 5:169427059-169427081 ATGTTGAAATCTGATCCCCAGGG - Intergenic
1001338847 5:170825301-170825323 ATGCTGAAGTCCTAACCCCCAGG - Intergenic
1001665005 5:173425407-173425429 ATGTTGAAGGCCTAACCCCCAGG - Intergenic
1001756661 5:174175546-174175568 ATGTTGAAGTCTTAACCCTCAGG - Intronic
1002347034 5:178555275-178555297 ATCTTGAAGTCCTAACCCTCAGG - Intronic
1002894069 6:1364893-1364915 ATGTTGAAGCCCTAACCTTCAGG - Intergenic
1002981405 6:2142284-2142306 ATGCTGAAGCCCTAACCTCCAGG + Intronic
1003112367 6:3260704-3260726 ATGTTGAAGTCCTAACCTCTGGG - Intronic
1003143830 6:3493340-3493362 GTGTTGAAGCCCTAACCCCAAGG - Intergenic
1003274601 6:4638536-4638558 CTGTTGAAGTCCTAACCCCCAGG - Intergenic
1003368143 6:5496788-5496810 ATATGAAAGTCCTAACCCCCAGG - Intronic
1003550396 6:7097987-7098009 ATGTTGAAGTTCTAAACCCCAGG - Intergenic
1003648676 6:7938139-7938161 AAGTAGAAGTCCTAACCCCCAGG + Intronic
1003652914 6:7977651-7977673 AAGTTGAAATCCTAAGCCCCTGG - Intronic
1003741754 6:8948320-8948342 ATGTTGAAGTCCTCACCTCCAGG - Intergenic
1003960133 6:11201216-11201238 AAGTTGAAGTTCTGACCACATGG - Intronic
1004002983 6:11612675-11612697 ATGTTGAAGTCCAAACCCTCAGG + Intergenic
1004020485 6:11771681-11771703 ATGTCGAAATCCTAACCTCCAGG + Intronic
1004021550 6:11780272-11780294 ATGTTGAAATCTTAACTCCCAGG - Intronic
1004042206 6:11991296-11991318 ATCTCGAACTCCTAAACCCAAGG + Intergenic
1004220372 6:13741817-13741839 ATGTTGAAGTCCTAACTCTCAGG - Intergenic
1004770536 6:18776178-18776200 ATGTTCAAGTCCTAACTCCTGGG - Intergenic
1004890308 6:20095003-20095025 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1005008420 6:21312982-21313004 ATGTTGAAATCCTAACCCCCAGG + Intergenic
1005050224 6:21677413-21677435 ATCTTGAACTCCTGACCTCATGG + Intergenic
1005103895 6:22202838-22202860 ATGTTGAAGTCCTCACCCCCAGG + Intergenic
1005201881 6:23355831-23355853 ATGTTGAAGTCCTGATCTCTAGG + Intergenic
1006506181 6:34490282-34490304 ATCTTGAACTCCTAGGCCCAAGG + Intronic
1007298626 6:40848658-40848680 ATGTTAAAGTCCTAACTCCCAGG - Intergenic
1007307094 6:40915450-40915472 ATGTTGAAGTCCCAAATCCCTGG - Intergenic
1007509367 6:42363568-42363590 ATGTTGACATCCTGACCCCTAGG + Intronic
1007944976 6:45818053-45818075 ATGTTGAAATTCTAATCCCCAGG + Intergenic
1007972707 6:46068604-46068626 ATGTTGAAATCCTAAACCCTTGG + Intronic
1008233632 6:49016238-49016260 ATGTTGAAGCCCTAACCACCCGG + Intergenic
1009618879 6:66046025-66046047 CTGTGGTAGTCCTAACTCCAGGG - Intergenic
1009809597 6:68643712-68643734 GTCTTGAAGTCCTGACCTCATGG - Intronic
1009845333 6:69127094-69127116 ATGTTGAACACATATCCCCATGG - Intronic
1010074293 6:71783071-71783093 ATGATGAAATTCTACCCCCATGG + Intergenic
1010761064 6:79723843-79723865 ATGTGGAAATCCTGACCCCCAGG - Intergenic
1010931977 6:81814701-81814723 ATATTGAAGTCCTAAACCCCAGG - Intergenic
1011741903 6:90369990-90370012 ATGTTGGAGTCCTAACTGCCAGG - Intergenic
1011769636 6:90661254-90661276 ATGTTGAAATCCTAATACCAAGG + Intergenic
1011787948 6:90867435-90867457 TTGTTGAAGTCCTAATCCCCAGG + Intergenic
1012554089 6:100490938-100490960 ATGTTGAAGTTCTAATTCCCAGG - Intergenic
1012647695 6:101708841-101708863 ATGTTGAAATCCTTACCCCCAGG + Intronic
1012968860 6:105705243-105705265 ATGTTGAAGTCCTAACCCCCCGG - Intergenic
1012986042 6:105877378-105877400 ATGTTGAACTCTTAATCCCAAGG - Intergenic
1013032327 6:106346090-106346112 GTCTTGAACTCCTAACCTCAAGG + Intergenic
1013059319 6:106616918-106616940 ATGTTGAAATCCTAACCCCCAGG + Intronic
1013580267 6:111527185-111527207 ATGTTGAAATCCTAACCTTAAGG + Intergenic
1013819642 6:114139012-114139034 ATGTTGAAATCCTAACTCCAAGG - Intronic
1014096726 6:117469412-117469434 ATGCTGAGGTCCTAAGACCAGGG - Intronic
1014269577 6:119321834-119321856 GTCTTGAACTCCTAACCTCAAGG + Intronic
1014634261 6:123825225-123825247 GTGTTGAAATCCTAACCCTAAGG - Intronic
1015107460 6:129553568-129553590 ATGTTCAAGTCCTAAGTCCTGGG - Intergenic
1015423508 6:133038311-133038333 ATCTTGAACTCCTGACCTCAGGG + Intergenic
1015517008 6:134092838-134092860 ATATTGAAGTCCTAACCCTCAGG + Intergenic
1015613351 6:135049381-135049403 ATGTTGAAATTCTAACCCCAAGG - Intronic
1015634630 6:135263449-135263471 ATGTTGAAATCCTAACCCCCAGG - Intergenic
1015819891 6:137249521-137249543 ATGTTGAATTCCTAATCCCCAGG - Intergenic
1016367606 6:143336574-143336596 ATGCTGAAATCCTAACCCCCAGG - Intronic
1016553107 6:145304584-145304606 ATGTTGAAATCTTAATCCCAAGG - Intergenic
1016582194 6:145641198-145641220 ATGTTAAAGTCCTAACGCTTAGG + Intronic
1016601651 6:145868292-145868314 ACGTTGAGGTCCTAACCCCCAGG - Intronic
1016752964 6:147651432-147651454 ATGTTGAAATCCTGACCCCCAGG + Intronic
1016764056 6:147772820-147772842 ATGTTGAAGCCCTAATCCCCAGG - Intergenic
1017137925 6:151164561-151164583 ATGACAAAGCCCTAACCCCAAGG + Intergenic
1017155356 6:151318054-151318076 ATGTCGAAATCCTAACTCTAAGG + Intronic
1017213675 6:151883983-151884005 ATGTTGAAATCTTACCCCCTGGG - Intronic
1017278876 6:152602172-152602194 CTGTTGAAGTTCTAACCTCCAGG + Intronic
1017751943 6:157496418-157496440 ATGTTGGAGTCCTAACCCCCAGG + Intronic
1018350806 6:162956835-162956857 AAGTTGAACTCTTAACCCCCAGG - Intronic
1018389983 6:163334963-163334985 GTGTTGAAGTCCTAACTCCCAGG + Intergenic
1018452838 6:163925104-163925126 ATGTTGAAATCCTTCCCTCAAGG + Intergenic
1018761816 6:166899876-166899898 GTGTTGAAATTCTAATCCCAAGG + Intronic
1018761822 6:166899913-166899935 GTGTTGAAATTCTAATCCCAAGG - Intronic
1018975654 6:168563548-168563570 GTGTTGAAATCCTCACCCCCAGG + Intronic
1018997515 6:168721422-168721444 ATGTTGAAGTCCTAATCCCCAGG + Intergenic
1019477530 7:1251234-1251256 ATGTTGGGGTCCTCACCCCCAGG + Intergenic
1019551049 7:1602712-1602734 ATGTTGAAGTCTTAACCCACAGG + Intergenic
1019790873 7:3013118-3013140 ATGTTGAGATCCTAATCCCAAGG + Intronic
1019791282 7:3015567-3015589 ATGTTGCAGGCCTAACCTCCAGG - Intronic
1019799693 7:3079156-3079178 ATGTTGACATCTTAACCCCCAGG + Intergenic
1019800003 7:3081331-3081353 ATGTTGACATCTTAACCCCCAGG + Intergenic
1019859731 7:3646521-3646543 ATGTTAAATTACTTACCCCAGGG + Intronic
1019968961 7:4524841-4524863 ATGTACAAGTTCTAACCCCCAGG + Intergenic
1019973430 7:4560983-4561005 AGGTTTAAGTCCTAACCCCCAGG + Intergenic
1020025726 7:4898565-4898587 ACGTTGAAAACCTAACTCCAAGG + Intergenic
1020203029 7:6095003-6095025 GTCTTGAACTCCTAACCTCAAGG + Intergenic
1020610467 7:10390281-10390303 ATGTTGATGTCCTAACCCACAGG - Intergenic
1020674969 7:11172094-11172116 GTGTTGAAGCCCTAACTCCCAGG - Intergenic
1020916592 7:14201309-14201331 ATATTGAAATTCTAACCCCTAGG - Intronic
1020950793 7:14674552-14674574 ATGCTGAAGTCCTAACTTCTGGG + Intronic
1021113331 7:16720897-16720919 GTGTTGAACTCCTGACCTCAAGG + Intergenic
1021122021 7:16806630-16806652 ATGTTGAAGTCTTAATCCCCAGG - Intronic
1022198849 7:28096036-28096058 ATGTTGAAGCCCTAACCCCCAGG - Intronic
1023349030 7:39300856-39300878 CTGTTGAAGTCCTAACCCCCAGG - Intronic
1023641074 7:42258831-42258853 ATGTTGAAATCCTAATCCCCAGG - Intergenic
1023781451 7:43659821-43659843 ATGTTGAAGCCCTAATTCCCAGG + Intronic
1024028027 7:45430931-45430953 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1024098647 7:46006585-46006607 ATATTGAACTCCTAACCCCCAGG + Intergenic
1024117794 7:46209693-46209715 ATGTTGAAGTTCCAACCCCCAGG - Intergenic
1024244621 7:47459877-47459899 ATGTTGAAGTCCTAGTGCCCAGG + Intronic
1024248485 7:47488650-47488672 ATGTTGAAGTCCAAATCCCCAGG - Intronic
1024546891 7:50529857-50529879 GTGTTGAAGCCCTAACCCCCAGG + Intronic
1024700317 7:51899413-51899435 ATGTTGAAATCCTCACTCCCAGG - Intergenic
1024812379 7:53227525-53227547 ATGTTGAAGCCTTAACCCACAGG + Intergenic
1024857691 7:53800881-53800903 GTGTTGAAATCCTAACCCCCAGG + Intergenic
1025007882 7:55368721-55368743 AGGTTGAAGTCCTAACCCATTGG + Intronic
1025124422 7:56333526-56333548 ATGTTAAAGTCCTAACCTCCAGG + Intergenic
1025606691 7:63044630-63044652 AAGTTGAAGCCCTACCCTCAAGG - Intergenic
1026092709 7:67314790-67314812 GTCTTGAAGTCCTGACCTCAAGG - Intergenic
1026764148 7:73149197-73149219 GTCTTGAAGTCCTGACCTCAAGG + Intergenic
1026997378 7:74626742-74626764 GTCTTGAACTCCTAACCTCAAGG - Intergenic
1027040616 7:74958967-74958989 GTCTTGAAGTCCTGACCTCAAGG + Intergenic
1027083020 7:75243390-75243412 GTCTTGAAGTCCTGACCTCAAGG - Intergenic
1027156568 7:75772437-75772459 ATCTTGAACTCCTGACCTCAAGG - Intronic
1027156926 7:75775000-75775022 ATCTTGAACTCCTGACCTCAAGG - Intronic
1027497919 7:78911330-78911352 ATGTTGAAATTCTAACCCCAAGG + Intronic
1027596971 7:80185818-80185840 ATGTTGAAACCCTAACCACGTGG + Intronic
1027782105 7:82532455-82532477 ATGTTGAAGTCTTAGCCCTCAGG - Intergenic
1027840420 7:83303974-83303996 ATATTGGAGAGCTAACCCCATGG + Intergenic
1028012607 7:85667326-85667348 ATCTTGAACTCCTGACCTCAGGG - Intergenic
1028335118 7:89643048-89643070 CTGTTAAAATACTAACCCCAGGG - Intergenic
1028613460 7:92738027-92738049 ATGTTGAAGTCCCACCTCTATGG - Intronic
1028666683 7:93351718-93351740 ATGTTGAAATCCTAATCCCAGGG - Intronic
1028853324 7:95561641-95561663 ATATTGAAGTCCTACCCTCCAGG + Intergenic
1029013468 7:97288078-97288100 ATGTTGAAATCCTATCCTTAAGG + Intergenic
1029054025 7:97721224-97721246 ATGTTGAAACCCTAACCCCAAGG - Intergenic
1029090721 7:98046078-98046100 ATGTTGAAGTCCCAACCTCCAGG + Intergenic
1029187023 7:98746687-98746709 ATGTTGAAATTCTAAACCCCAGG - Intergenic
1029554921 7:101262303-101262325 ATGTTGAAGTCCTAACCTCCAGG + Intergenic
1030393157 7:108952293-108952315 ATGTTGAAATTCTAGCCCCTGGG + Intergenic
1030508446 7:110454040-110454062 ATGTTGAACTCCTATCTTCAAGG - Intergenic
1030618933 7:111768886-111768908 ATGTTGAAATCCTAACCCCCAGG + Intronic
1030688766 7:112511805-112511827 GTGTTGAAGTCCTAATCCTCAGG - Intergenic
1030827441 7:114176855-114176877 ATCTTCCAGTCCTTACCCCAGGG + Intronic
1031232955 7:119133967-119133989 ATGTTGAAATCCTAACCCCCAGG + Intergenic
1031258288 7:119484112-119484134 ATGTTAAAGTCATAACTCCAGGG + Intergenic
1031748479 7:125537660-125537682 GTCTTGAACTCCTGACCCCAAGG - Intergenic
1031766313 7:125781711-125781733 ATGCTGAAATCCTAACCCCTAGG + Intergenic
1032397169 7:131598927-131598949 ATGTTCAAGCCCTAACCCCTGGG - Intergenic
1032481814 7:132253460-132253482 ATCTTGAACTCCTGACCTCAAGG + Intronic
1032687560 7:134251122-134251144 ATGTTGGAGTCCTGACCCCCAGG + Intronic
1032890866 7:136193222-136193244 ATATTCAAGTCCTAGCCCCTGGG + Intergenic
1033704897 7:143876912-143876934 ATTTTGAAGTCCTAACCCATAGG + Intronic
1033846924 7:145444578-145444600 GTATCGAAATCCTAACCCCAGGG - Intergenic
1033883947 7:145921367-145921389 ATCTTGAACTCCTGACCTCAAGG + Intergenic
1034151678 7:148921803-148921825 AAGTTGAAGTCCTAATGCCCAGG + Intergenic
1034191138 7:149214382-149214404 ATGTTGAAGTCCTAACCCCCAGG - Intronic
1034362304 7:150510936-150510958 ATGTTCAAGATCTAACCCCTAGG + Intergenic
1034481866 7:151327958-151327980 ATGTTGAAGCCTAACCCCCAAGG + Intergenic
1034542250 7:151765703-151765725 TTGTGGAAGTCCTGACCCCCAGG - Intronic
1034545751 7:151787707-151787729 ATGTTGAAGTCCTGCCCCCCAGG + Intronic
1034672440 7:152868873-152868895 ATGCTGAGGTCCTAACTCCCAGG - Intergenic
1034743237 7:153497607-153497629 ATGTTGAAATCCGAAGCCCTCGG - Intergenic
1034937066 7:155207060-155207082 ATGTTGAAGTCTTAACCCCCAGG - Intergenic
1034938690 7:155216132-155216154 GTGTTGCAGCCCTAACCCCCAGG - Intergenic
1034986232 7:155517105-155517127 ATGTTGAAGCCCTAAACCCCGGG + Intronic
1034997605 7:155587913-155587935 ATGCTGAAATCCTAACCCCAGGG - Intergenic
1035046689 7:155972556-155972578 ATGTTGAAGTCCTGACCCCTAGG + Intergenic
1035116789 7:156531592-156531614 ATGTTGAAGTCCTGATCCCCAGG - Intergenic
1035427408 7:158789571-158789593 GTCTTGAAATCCTAACCTCAAGG + Intronic
1035433248 7:158838218-158838240 ATGTTGAATTGCAATCCCCAGGG - Intergenic
1035529249 8:337995-338017 ACGTTGAAATCCTAACCCCCAGG + Intergenic
1035837526 8:2770596-2770618 ATGTTGGAGTTCCAGCCCCAGGG - Intergenic
1036211267 8:6843047-6843069 ATGTGGAAGTCCTAACTCCCAGG + Intergenic
1036233986 8:7022417-7022439 ATGTTGAAGTCTTAGACCCTAGG + Intergenic
1036607565 8:10320975-10320997 ATGTTGGAGTCCTAAAACCTCGG - Intronic
1036684972 8:10903525-10903547 ATGCTGAAGCTCTAACCCCTAGG + Intronic
1037232992 8:16682126-16682148 ACGTTGAAGTCCTAACCTTCAGG - Intergenic
1037313626 8:17581087-17581109 ATGCTGAAGTCCTAACTCCCAGG - Intronic
1037579293 8:20235190-20235212 ATGTTGATGTCCTAACTCCCAGG + Intergenic
1037817032 8:22117804-22117826 ATCTTGCAGCCCTAAGCCCAGGG - Intronic
1037836760 8:22219273-22219295 AGGTGGAAATTCTAACCCCAAGG + Intergenic
1038208696 8:25494706-25494728 ATATTGAAGTCCTAACTCCCAGG + Intronic
1038433812 8:27520766-27520788 GTGTTGAAGTCCTAACCCCCAGG - Intronic
1038524335 8:28260356-28260378 ATGGTGAAGCCCTAACCCCCAGG + Intergenic
1038803121 8:30767313-30767335 GTGTTGAACTCCTGACCTCATGG - Intergenic
1039610558 8:38915622-38915644 ATGTTGAAGTACTAACCCTAAGG - Intronic
1039896633 8:41721078-41721100 ATGCTGCAGTCTTAACCCCCAGG + Intronic
1040866556 8:52053959-52053981 ATGTTGAAATCCTAACCCCCCGG - Intergenic
1041240294 8:55843463-55843485 ATGTTGAAATCCTGACCCTCAGG + Intergenic
1041871138 8:62635544-62635566 ATGTTGACAGCCTAACCCCAAGG + Intronic
1042151946 8:65797193-65797215 ATGTCAAAGTCCTAACCCCCAGG + Intronic
1042383962 8:68151457-68151479 ATGACAAAGTCCTAACCCCTTGG - Intronic
1042581856 8:70288359-70288381 GTCTTGAACTCCTAACCTCAGGG - Intronic
1042797152 8:72676944-72676966 CTGTTGAACTCTTAACCCCTCGG + Intronic
1043170342 8:76958393-76958415 AGGGTGAAGTCCTAACCTGATGG - Intergenic
1043382277 8:79715633-79715655 ATGTAGAAATCCTAACCCCAAGG - Intergenic
1043578026 8:81679915-81679937 GTGTTGAACTCCTGACCTCATGG - Intronic
1043764873 8:84118686-84118708 AGGTTGAAGCCCTAACCCCCTGG + Intergenic
1043846977 8:85175132-85175154 ATGTTGAAACCCTAACCCTCGGG + Intergenic
1043916849 8:85932947-85932969 ATATTGTTGTCCTAACCACATGG - Intergenic
1044085231 8:87935535-87935557 ATGTTAAAATCCTAGCCCCAAGG - Intergenic
1044106154 8:88209906-88209928 ATGTTGAAATCCTAACCCCAAGG + Intronic
1044199493 8:89416700-89416722 ATGTTGAAAACCTAACCCCAAGG + Intergenic
1044223282 8:89695437-89695459 ATGTTGAAATCCTAACCCCAAGG + Intergenic
1044725640 8:95192319-95192341 ATGCTGAAATCCTAACTCCCAGG + Intergenic
1044875398 8:96660434-96660456 ACGTTAAAGCCCTAACCCCCAGG - Intronic
1044937356 8:97305940-97305962 TGGTTGAAATCCTAATCCCAAGG - Intergenic
1045003704 8:97899717-97899739 ATGTTGAAGTCCTCACCCCCAGG - Intronic
1045508098 8:102792905-102792927 GTGTTGGAGTCCTAACCCTCAGG + Intergenic
1045804292 8:106139072-106139094 ATGTTGAATTTCTAACCCCTAGG - Intergenic
1045840217 8:106571477-106571499 ATGTTGAAGCCCTAGCTCCCAGG - Intronic
1047017396 8:120738006-120738028 ATATTGAAATCCTAACTCCCAGG + Intronic
1047238607 8:123064730-123064752 GTTTTGAACTCCTAGCCCCAAGG + Intronic
1047361847 8:124176250-124176272 ATGTTGAGGTCCTAACCTTCAGG + Intergenic
1047496912 8:125415123-125415145 ATGGTGAAGTCCTAAGCCCCAGG - Intergenic
1047626318 8:126659775-126659797 ATCTTAAAGTCCCAACCCCCAGG - Intergenic
1047761079 8:127955038-127955060 ATGTTGAAGTCCTAGTGCCAAGG + Intergenic
1048049550 8:130804473-130804495 ATGTTGAAGTCCTAACCCCAAGG - Intronic
1048071452 8:131026130-131026152 ATGTTAAAATGCTAACCCTAAGG + Intronic
1048195032 8:132325435-132325457 ACGTTGAAGTCCTAACCCCTAGG + Intronic
1048267603 8:133001192-133001214 ACGTTGCAGTCCTAACCCGTAGG - Intronic
1048314508 8:133352215-133352237 ATGTTGAAGTCCTAAACCCCAGG - Intergenic
1048399046 8:134046114-134046136 ACGTTGAAGCCCTAACCCCTAGG - Intergenic
1048874612 8:138827247-138827269 ATGTTGAAATCTTCACACCAAGG + Intronic
1048932647 8:139327183-139327205 ATGTTGAAGCCCTAACACCCAGG + Intergenic
1048978415 8:139688934-139688956 ATGTTGATATCCTAACCCCCAGG + Intronic
1049151250 8:141036877-141036899 CTGTTCAAGTCCTAACCCCTTGG - Intergenic
1049254789 8:141608026-141608048 ATGAGGAAATCCTAACCCCCAGG + Intergenic
1049332853 8:142064446-142064468 ATGTTAAAGTCCTAACCTCCAGG - Intergenic
1049450449 8:142658679-142658701 ATGTTGAAACCCTGACCCCCAGG - Intronic
1050032879 9:1404882-1404904 ACGTTGAAGTCCTAACACCCAGG - Intergenic
1050164053 9:2746067-2746089 ATGTTGAAGTTCTTACCCCCAGG + Intronic
1050185022 9:2964244-2964266 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1050460888 9:5876433-5876455 ATGTTGATGTCCTAACCCCCTGG + Intergenic
1050504387 9:6332295-6332317 AGGTCGAAATCCTAACCACAGGG + Intergenic
1050535111 9:6624227-6624249 GCTTTGAAATCCTAACCCCATGG + Intronic
1050981390 9:12020293-12020315 ATGAGAAAGTCCTATCCCCAAGG - Intergenic
1051112669 9:13657100-13657122 GTCTTGAAGTCCTGACCTCAAGG - Intergenic
1052074291 9:24121704-24121726 ATGTTGAAATCTTAACCCCCAGG + Intergenic
1052392657 9:27898945-27898967 ATGTTGACCTCTTAACCCCAAGG - Intergenic
1054878768 9:70123585-70123607 ATGTTGAAGTCCTAACCCCCAGG + Intronic
1056548016 9:87629045-87629067 ATGTTGAAGTCCTAACCTCCAGG + Intronic
1056621946 9:88221884-88221906 ATGTTGAAGCCCTAACAGCCAGG + Intergenic
1056626899 9:88261102-88261124 ATGTTGAGGCCCTAATCCCCAGG - Intergenic
1056661745 9:88548792-88548814 GTGTTGAAGTCCTAACCCCTAGG + Intronic
1056693045 9:88824147-88824169 CTGTTGAAATCCTAAACCCAAGG + Intergenic
1057283618 9:93729865-93729887 ATGCTGAAGTGCTGACCCCCAGG + Intergenic
1057308949 9:93929532-93929554 GTATTGAAGTCCTAACCCCCAGG + Intergenic
1057552326 9:96061077-96061099 AAGTTGAAGTCTTAACCCTGAGG + Intergenic
1057705901 9:97394863-97394885 ATGTTGAAGTGCTAACCCCCAGG + Intergenic
1058347469 9:103980971-103980993 TTGTTGAAATCCTAACCTTAAGG + Intergenic
1058777878 9:108303035-108303057 ATGTTGTAGTCCTAACCGCCAGG + Intergenic
1058975678 9:110123521-110123543 ATGTTGAACTCCTAACACCAAGG - Intronic
1059067778 9:111103472-111103494 ATGTTGAAGTCCCAACCCCCAGG + Intergenic
1059207350 9:112479350-112479372 ATGTTGAAATCCTAATCCCAAGG + Intronic
1059472334 9:114515157-114515179 ATGTGGAAGTCCTAATCCTGAGG - Intergenic
1059925576 9:119205991-119206013 ATGTTAAAGTCCTAGCCCCCAGG + Intronic
1061276862 9:129573879-129573901 ATGTTGAAGTCCTAACCCCCAGG + Intergenic
1061322729 9:129841422-129841444 ATGCTGAAGTTCTAACCACCAGG - Intronic
1061410882 9:130420833-130420855 ACGTTGAAGTCTTAACCCCCAGG - Intronic
1203491441 Un_GL000224v1:109122-109144 ATGTTGAAATCTTATCACCAAGG - Intergenic
1203504065 Un_KI270741v1:50992-51014 ATGTTGAAATCTTATCACCAAGG - Intergenic
1185568933 X:1117631-1117653 GTCTTGAACTCCTAACCTCAAGG - Intergenic
1185571367 X:1137280-1137302 ATGTTGAAGCCCTAATCCTCAGG - Intergenic
1185627873 X:1495290-1495312 ACGTTAAAGTCCTAACCCCTAGG + Intronic
1185655045 X:1677792-1677814 AGGTTGAAGCCCTAACCCCAGGG + Intergenic
1185714125 X:2327658-2327680 ATGTTAAAGCCCTAACGCCCAGG + Intronic
1185770336 X:2761112-2761134 ATATTGAAGGCCTAATCCCTAGG + Intronic
1185776378 X:2805853-2805875 AGGTCGCAGTCCTAACCCCCAGG - Intronic
1185790238 X:2923773-2923795 ACGTCGAAGTCCTGACCCCCAGG - Intronic
1185800723 X:3008021-3008043 GTGCTGAAGTCCTAACCCCCAGG - Intronic
1185856533 X:3541439-3541461 ATGTTGAAATCCTAACCTCCAGG - Intergenic
1186120852 X:6359519-6359541 ATATTGAACCCCTAACCCCTAGG + Intergenic
1186186866 X:7029301-7029323 ACATTGAAGTCCTAGCCCCCAGG - Intergenic
1186229557 X:7438758-7438780 ATGTTGAAGCCCTAACTCTCAGG + Intergenic
1186371704 X:8953479-8953501 ATGTTGGAGTCCTAACCCCCAGG - Intergenic
1186395606 X:9205810-9205832 ATGTTGAAATCTAACCCCCAAGG - Intergenic
1186403068 X:9277415-9277437 AGGTTGAAATCTTAACCCCCAGG - Intergenic
1186782770 X:12929942-12929964 ATGTTGAAGTCTTAACCCCCAGG - Intergenic
1187417067 X:19102692-19102714 ATTTTGAAGCCCTAACCCCCAGG + Intronic
1187523559 X:20034498-20034520 GAGTTGAAACCCTAACCCCATGG + Intronic
1187535704 X:20140167-20140189 GTGTAGAAGTCCTATCCCCTTGG + Intronic
1187909890 X:24101851-24101873 GTCTTGAACTCCTAACCTCAAGG + Intergenic
1188217240 X:27493491-27493513 GTCTTGAACTCCTAACCTCAGGG - Intergenic
1188283122 X:28294966-28294988 ATGTTGAAATTCTAATCCCCAGG - Intergenic
1188840690 X:35013456-35013478 ATGTTGAAATCCTGACCCTAAGG + Intergenic
1189060921 X:37752963-37752985 ATATTGAAGTCTTAGCCCCTAGG + Intronic
1189135039 X:38540171-38540193 ATGTTGGAGTCCAAAGGCCAGGG + Intronic
1189219928 X:39362882-39362904 ATGTTGAAATCCAACCCCCAAGG + Intergenic
1189260274 X:39673523-39673545 ATGTTGAAACCCAACCCCCAAGG - Intergenic
1189347569 X:40253527-40253549 ATGTTGAAGTCCTAACTCGCAGG + Intergenic
1189367943 X:40403505-40403527 ATGTTCAAGTCCTATGCCCTGGG + Intergenic
1189378847 X:40487219-40487241 GTGTTGAAGTCCTAATCCCCAGG - Intergenic
1189570261 X:42287490-42287512 ATGTTGAAGCCCTAGCACCAAGG - Intergenic
1189958911 X:46306573-46306595 ACCTTGAAGTCCTAGCCCCAAGG - Intergenic
1190073128 X:47295134-47295156 CTGTTGAAATCCTAATCACAAGG + Intergenic
1190224393 X:48534169-48534191 ATGTTGAAGCCCTAATATCAGGG - Intergenic
1190623705 X:52314867-52314889 ATGTTGAAATCCTAATCCCCAGG - Intergenic
1192896375 X:75446875-75446897 ATATTGAAATCCTGTCCCCAAGG - Intronic
1195406057 X:104514502-104514524 ATGCTGAAGCTCTAACCCCCAGG - Intergenic
1195592069 X:106641211-106641233 ATGATGAAGTCCTAACCCTCAGG - Intronic
1195784597 X:108505483-108505505 ATGTTGAATCTCAAACCCCAAGG + Intronic
1196669434 X:118349765-118349787 GTCTTGAACTCCTAACCTCATGG + Intronic
1196833378 X:119793403-119793425 GTGTTGAAGCCCTAATCCCCAGG - Intergenic
1197071284 X:122300512-122300534 ACATTGAAGTCCTAAACCCCAGG - Intergenic
1197505043 X:127291371-127291393 ATGTTGAAGTCCTAATCCCCAGG + Intergenic
1198248708 X:134857491-134857513 ATCTTGAAATTCTAACCCCCAGG - Intergenic
1198260928 X:134964305-134964327 ATGTTGAAGTCCTAACCCCCAGG - Intergenic
1200017039 X:153173790-153173812 ATGTTGAAATCCTAACACCAAGG + Intergenic
1200254677 X:154573839-154573861 ATGTTCAAGTCCTAACACCTGGG - Intergenic
1200263092 X:154630569-154630591 ATGTTCAAGTCCTAACACCTGGG + Intergenic
1200753483 Y:6968196-6968218 ATGGTGAAGTCCTAACCCTGAGG - Intronic
1200876936 Y:8166411-8166433 ATGTTGAAATGATAACCCTAGGG - Intergenic
1201242720 Y:11974190-11974212 ATATTAAAGTCCTATCCCCCAGG - Intergenic
1201293599 Y:12445622-12445644 AGGTCGCAGTCCTAACCCCCAGG + Intergenic
1201477198 Y:14395300-14395322 ATATTGAATCCCTAACCCCTAGG - Intergenic