ID: 941836009

View in Genome Browser
Species Human (GRCh38)
Location 2:170021579-170021601
Sequence GGACTTCAACATATGAATTT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 10818
Summary {0: 148, 1: 1017, 2: 2212, 3: 3420, 4: 4021}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941835999_941836009 7 Left 941835999 2:170021549-170021571 CCCCACCTCCTTATACTAACCTT No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836005_941836009 2 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836000_941836009 6 Left 941836000 2:170021550-170021572 CCCACCTCCTTATACTAACCTTG No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836001_941836009 5 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941836006_941836009 -1 Left 941836006 2:170021557-170021579 CCTTATACTAACCTTGGGGTTAG No data
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021
941835998_941836009 26 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836009 2:170021579-170021601 GGACTTCAACATATGAATTTTGG 0: 148
1: 1017
2: 2212
3: 3420
4: 4021

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836009 Original CRISPR GGACTTCAACATATGAATTT TGG Intronic
Too many off-targets to display for this crispr