ID: 941836010

View in Genome Browser
Species Human (GRCh38)
Location 2:170021582-170021604
Sequence CTTCAACATATGAATTTTGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11268
Summary {0: 154, 1: 911, 2: 2311, 3: 3605, 4: 4287}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941836006_941836010 2 Left 941836006 2:170021557-170021579 CCTTATACTAACCTTGGGGTTAG No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941836000_941836010 9 Left 941836000 2:170021550-170021572 CCCACCTCCTTATACTAACCTTG No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941835998_941836010 29 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941835999_941836010 10 Left 941835999 2:170021549-170021571 CCCCACCTCCTTATACTAACCTT No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941836005_941836010 5 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941836001_941836010 8 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287
941836008_941836010 -9 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836010 2:170021582-170021604 CTTCAACATATGAATTTTGGTGG 0: 154
1: 911
2: 2311
3: 3605
4: 4287

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836010 Original CRISPR CTTCAACATATGAATTTTGG TGG Intronic
Too many off-targets to display for this crispr