ID: 941836011

View in Genome Browser
Species Human (GRCh38)
Location 2:170021583-170021605
Sequence TTCAACATATGAATTTTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 7824
Summary {0: 24, 1: 357, 2: 1394, 3: 2605, 4: 3444}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941835998_941836011 30 Left 941835998 2:170021530-170021552 CCTAATCACTTCTCAAAGGCCCC 0: 8
1: 135
2: 772
3: 2086
4: 3524
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941835999_941836011 11 Left 941835999 2:170021549-170021571 CCCCACCTCCTTATACTAACCTT No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836001_941836011 9 Left 941836001 2:170021551-170021573 CCACCTCCTTATACTAACCTTGG No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836008_941836011 -8 Left 941836008 2:170021568-170021590 CCTTGGGGTTAGGACTTCAACAT 0: 5
1: 41
2: 152
3: 277
4: 550
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836000_941836011 10 Left 941836000 2:170021550-170021572 CCCACCTCCTTATACTAACCTTG No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836005_941836011 6 Left 941836005 2:170021554-170021576 CCTCCTTATACTAACCTTGGGGT No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444
941836006_941836011 3 Left 941836006 2:170021557-170021579 CCTTATACTAACCTTGGGGTTAG No data
Right 941836011 2:170021583-170021605 TTCAACATATGAATTTTGGTGGG 0: 24
1: 357
2: 1394
3: 2605
4: 3444

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941836011 Original CRISPR TTCAACATATGAATTTTGGT GGG Intronic
Too many off-targets to display for this crispr