ID: 941847501

View in Genome Browser
Species Human (GRCh38)
Location 2:170148179-170148201
Sequence TCCCACTACTGCCTATATCA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941847497_941847501 9 Left 941847497 2:170148147-170148169 CCTTTCATTTCTTAGCTCCATCA No data
Right 941847501 2:170148179-170148201 TCCCACTACTGCCTATATCAGGG No data
941847498_941847501 -8 Left 941847498 2:170148164-170148186 CCATCATCACCTAGATCCCACTA No data
Right 941847501 2:170148179-170148201 TCCCACTACTGCCTATATCAGGG No data
941847496_941847501 27 Left 941847496 2:170148129-170148151 CCTGGTTACTGGGTGGCTCCTTT No data
Right 941847501 2:170148179-170148201 TCCCACTACTGCCTATATCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941847501 Original CRISPR TCCCACTACTGCCTATATCA GGG Intergenic
No off target data available for this crispr