ID: 941850683

View in Genome Browser
Species Human (GRCh38)
Location 2:170177127-170177149
Sequence TACCTAGATTTATCTGCTCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 108
Summary {0: 1, 1: 0, 2: 2, 3: 7, 4: 98}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941850681_941850683 19 Left 941850681 2:170177085-170177107 CCTCATCTACACTAATCCTTTTC 0: 1
1: 0
2: 0
3: 17
4: 226
Right 941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG 0: 1
1: 0
2: 2
3: 7
4: 98
941850680_941850683 23 Left 941850680 2:170177081-170177103 CCTGCCTCATCTACACTAATCCT 0: 1
1: 0
2: 2
3: 11
4: 152
Right 941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG 0: 1
1: 0
2: 2
3: 7
4: 98
941850682_941850683 3 Left 941850682 2:170177101-170177123 CCTTTTCACTTCTTCATTCAAAA 0: 1
1: 0
2: 4
3: 71
4: 732
Right 941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG 0: 1
1: 0
2: 2
3: 7
4: 98

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941850683 Original CRISPR TACCTAGATTTATCTGCTCC AGG Intergenic
904800018 1:33085999-33086021 TGCCTAGAGTTTTCTGCTTCAGG + Intronic
913450828 1:118991495-118991517 TACCTAGGTTTCCCTGCTACAGG + Intergenic
1066616320 10:37298688-37298710 TCCCTGGATTTTTCTGCTCTGGG + Intronic
1067275777 10:44832941-44832963 TAACAAGCTTTATCTGCTCAGGG + Intergenic
1069327084 10:67244426-67244448 TAACTAGATTCATCTGATCGAGG + Intronic
1072934833 10:99702130-99702152 TACTAACATTTATCAGCTCCTGG + Intronic
1073303025 10:102482422-102482444 TACATGGATTTATTTGCTCATGG + Intronic
1074972317 10:118549300-118549322 CACCCAGGTTTCTCTGCTCCAGG - Intergenic
1075742738 10:124705756-124705778 GACCTAGGTCTATCTGCTCAAGG + Intronic
1080891930 11:36416686-36416708 TACCTAGACTTTTCTCTTCCTGG + Intronic
1081632312 11:44697964-44697986 TGCCTGGAACTATCTGCTCCCGG - Intergenic
1085049493 11:73372895-73372917 CCCCTAGATTTCTCTTCTCCAGG + Intergenic
1090325358 11:125881652-125881674 TACCTACTTTTATCTCCACCTGG + Intergenic
1095881337 12:47140407-47140429 TATCTAGATTTTTATGCCCCTGG + Intronic
1097288469 12:57895340-57895362 AACCTATATTTTTCTTCTCCAGG + Intergenic
1100699574 12:97132039-97132061 TATCTAGTTTTATCTGCACTGGG - Intergenic
1100828021 12:98492887-98492909 TCCTTAGAGTTATCTGTTCCTGG - Intronic
1101056167 12:100916748-100916770 CACCTAGAATTCTCTGCTTCAGG - Intronic
1103346496 12:120254391-120254413 TAAGTAGATTTAGCTGCTCTTGG + Intronic
1103394040 12:120594200-120594222 TACCCAGATTGATGTGTTCCTGG + Intergenic
1104897200 12:132170229-132170251 TACACAGATTTCTCTGCTCTGGG + Intergenic
1106024679 13:25945740-25945762 TCCCCGGATTTTTCTGCTCCGGG + Intronic
1107612935 13:42134539-42134561 TTGCTAGATTCTTCTGCTCCAGG + Intronic
1110101038 13:71602844-71602866 TCCCTAGATTTCTCTCCCCCTGG - Intronic
1113649341 13:112024617-112024639 TACCTGGATTTTTCTGCTACTGG - Intergenic
1116279117 14:42879318-42879340 TGCCTGGATTTCTCTGCTCATGG - Intergenic
1116501673 14:45631716-45631738 TACCTGGTTTTATCTACTCTGGG + Intergenic
1119887473 14:78154930-78154952 CACCTCGATATGTCTGCTCCTGG + Intergenic
1126396981 15:48228806-48228828 TACCTAGACTTTCCTACTCCTGG + Intronic
1127649089 15:60988780-60988802 GACCTAGATTTATCTACTCCAGG + Intronic
1128219127 15:65955352-65955374 TACCCAGTTTTATCTGCACTGGG + Intronic
1134775557 16:16850214-16850236 TACCGAGGTTTATCTCCTCCAGG - Intergenic
1140444828 16:75017567-75017589 AATCTATATTGATCTGCTCCTGG + Intronic
1141578227 16:84979104-84979126 TTAGTAGATTTCTCTGCTCCAGG + Intronic
1143690837 17:8563806-8563828 TACCTAGCTTTAACTGCTGGAGG + Intronic
1147732515 17:42612851-42612873 CATCAAGATTTATCTGCTTCTGG + Intronic
1148088019 17:45006428-45006450 GATTTGGATTTATCTGCTCCTGG - Intergenic
1148638600 17:49168244-49168266 TTCCTAGTATTTTCTGCTCCTGG - Intronic
1151999384 17:77635802-77635824 TACCTTCATTTCTCTCCTCCAGG - Intergenic
1154077396 18:11217402-11217424 TTCTTATATTTATCTGCTCCTGG - Intergenic
1155413127 18:25567806-25567828 TACCTAGAGTGATCTAGTCCAGG - Intergenic
1159171717 18:64777754-64777776 TACCCAGATTTATCGGCCTCGGG + Intergenic
1159779650 18:72646137-72646159 TACCTTGATTTATCTGCTCGAGG - Intergenic
1163166384 19:15500888-15500910 TCCCTGCATTTATCTCCTCCCGG + Intergenic
1166460276 19:42982010-42982032 TACCTTGACTTATCTTCACCAGG + Intronic
1166477553 19:43141717-43141739 TACCTTGACTTATCTTCACCAGG + Intronic
929242971 2:39671388-39671410 TCCCTAGATATATCTGCTCTTGG - Intronic
929486089 2:42356146-42356168 TGCCTAGAATGATCTTCTCCAGG + Intronic
933634254 2:84689938-84689960 TTCTTAGCTTTATCTTCTCCAGG + Intronic
936691169 2:114890849-114890871 CACCGAGTTTTATCTGCTACTGG + Intronic
936691179 2:114890976-114890998 CACCGAGTTTTATCTGCTACTGG + Intronic
939816069 2:146898786-146898808 TTCCAAAATTTAGCTGCTCCTGG + Intergenic
941850683 2:170177127-170177149 TACCTAGATTTATCTGCTCCAGG + Intergenic
942269436 2:174259190-174259212 TTCCTAAAGTTATCTGATCCTGG - Intergenic
943008977 2:182423699-182423721 TACCTAGATAAATGTGCTACAGG - Intronic
945570039 2:211455829-211455851 TACCTAATTTTATCAGTTCCAGG + Intronic
946584184 2:221165665-221165687 TTCTTAAATTCATCTGCTCCAGG + Intergenic
1169752312 20:9006936-9006958 TCCCTAGAGTCATCTGCTACGGG + Intergenic
954543251 3:51410381-51410403 TACCCAGGTGTATCTGATCCAGG + Intronic
958006464 3:87818463-87818485 TCCCCAGATTTTTCTGCTGCTGG - Intergenic
963082492 3:141407273-141407295 AAACTAGATTTATCTGACCCCGG - Intronic
963222858 3:142830182-142830204 TCTCTAGAGTTATCTGGTCCTGG - Intronic
964767751 3:160195175-160195197 CACCCAGATTTTTCTGCTCCAGG + Intergenic
970060081 4:12023425-12023447 TACCTCGAAATGTCTGCTCCAGG + Intergenic
971009914 4:22422634-22422656 TACATAGATGTATCATCTCCTGG + Intronic
971976140 4:33690194-33690216 TAACTAGCTTTGTCTGCTCAAGG + Intergenic
975657132 4:76652936-76652958 CACCATGATATATCTGCTCCAGG - Intronic
977220231 4:94329484-94329506 TAGCTAGTTTTATCTCCTCCAGG - Intronic
977491960 4:97725543-97725565 TACCAACAGTTATGTGCTCCTGG - Intronic
978111252 4:104966528-104966550 TAACTAGTTTTATCAGCCCCTGG - Intergenic
978282871 4:107037484-107037506 TGCTTGGATTTCTCTGCTCCTGG - Intronic
979295392 4:119027024-119027046 GACTTAGATTTTTCAGCTCCCGG - Exonic
979579185 4:122335739-122335761 TAACTAAATATATCTGCTTCAGG - Intronic
980818176 4:137976050-137976072 TACCTATATTTAATTGCTTCTGG + Intergenic
983047815 4:163007589-163007611 TACCTAGAACTCTCTGCCCCTGG - Intergenic
984248486 4:177304049-177304071 AACCTACATTTTTTTGCTCCTGG - Intergenic
984993809 4:185408420-185408442 TATATAGATTTATGTGGTCCAGG - Exonic
986053728 5:4115058-4115080 TCCTTAGATTCAGCTGCTCCTGG + Intergenic
989084780 5:37664345-37664367 TCTCCAGTTTTATCTGCTCCTGG + Intronic
991372577 5:65934804-65934826 TACCTAGGTTTATCTTCGCAAGG + Intronic
991532958 5:67636083-67636105 TTCCTAGATTCCTCAGCTCCAGG + Intergenic
998659701 5:144222412-144222434 TATCCTCATTTATCTGCTCCAGG - Intronic
1000115145 5:158147011-158147033 TACCTACATTCATCTACACCGGG + Intergenic
1002406166 5:179033987-179034009 TTCCTAGATTTATCTGTGTCTGG - Exonic
1003381422 6:5628093-5628115 TTCCTACAGTTTTCTGCTCCTGG - Intronic
1008803032 6:55393214-55393236 TACCTAAATTTACTTTCTCCAGG - Intronic
1009458425 6:63884034-63884056 TACCTAGAATTATAAGCTCCAGG + Intronic
1010256367 6:73762819-73762841 TACCTGGATCTATCTTCCCCTGG + Exonic
1010823557 6:80445701-80445723 AACCTACCCTTATCTGCTCCTGG + Intergenic
1016652270 6:146475938-146475960 AACCTGGATTTATCTGGTACTGG + Intergenic
1022433151 7:30347800-30347822 AATCTAGATTTATATTCTCCAGG + Intronic
1028127955 7:87136166-87136188 TAACTAGATCTATATGATCCAGG + Intergenic
1028193970 7:87883586-87883608 TACCTACATTTATTTATTCCAGG - Intronic
1037925573 8:22841631-22841653 AGCCTGGATTTATCTGCACCAGG - Intronic
1043632689 8:82356378-82356400 TATCTCAATTTATCTGGTCCTGG - Intergenic
1046021785 8:108674064-108674086 TACCTAGTTTTGTCAACTCCAGG - Intronic
1048151363 8:131898109-131898131 TAACTGGTTTTATCTGCTCAGGG + Intergenic
1051741253 9:20254555-20254577 TACCTCTATTAATCTGCTTCAGG + Intergenic
1052446154 9:28564348-28564370 TATTTAGAATTATCTACTCCCGG - Intronic
1054848042 9:69817763-69817785 TGCCTACATTTTTCTGATCCAGG + Intergenic
1059031093 9:110697129-110697151 TACCTAAATTAATCTTCACCAGG - Intronic
1061291457 9:129652644-129652666 CACCTGGCTTTACCTGCTCCCGG - Intergenic
1061646717 9:132008965-132008987 TCACCAGATTTATCTGCTGCTGG - Intronic
1186187621 X:7037312-7037334 TACCTTGACTTATCTTCACCAGG + Intergenic
1194567765 X:95514559-95514581 GACCAAGATTTATCTACTTCTGG + Intergenic
1195069115 X:101262562-101262584 AACCTAGTTTGATCTGCTGCAGG + Exonic
1198030026 X:132746044-132746066 TACTTAGACTCATTTGCTCCAGG - Intronic
1202237486 Y:22728748-22728770 TACCTAGATTTGTCTGGGCACGG - Intergenic