ID: 941853885

View in Genome Browser
Species Human (GRCh38)
Location 2:170211098-170211120
Sequence TGGGGTTCCATGAGAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941853883_941853885 -9 Left 941853883 2:170211084-170211106 CCACTTTTAATTCCTGGGGTTCC No data
Right 941853885 2:170211098-170211120 TGGGGTTCCATGAGAAAAACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941853885 Original CRISPR TGGGGTTCCATGAGAAAAAC AGG Intronic
No off target data available for this crispr