ID: 941857233

View in Genome Browser
Species Human (GRCh38)
Location 2:170243387-170243409
Sequence TTCTAAGCACAGATAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941857229_941857233 7 Left 941857229 2:170243357-170243379 CCTGAGGTAGTTCTCATATTGGT No data
Right 941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG No data
941857227_941857233 19 Left 941857227 2:170243345-170243367 CCAGCAGGCTAGCCTGAGGTAGT No data
Right 941857233 2:170243387-170243409 TTCTAAGCACAGATAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941857233 Original CRISPR TTCTAAGCACAGATAGAGGA AGG Intronic
No off target data available for this crispr