ID: 941857753

View in Genome Browser
Species Human (GRCh38)
Location 2:170247911-170247933
Sequence ATGGTGAGGAGCACTGTGTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941857749_941857753 -9 Left 941857749 2:170247897-170247919 CCATAGCACAAAGAATGGTGAGG No data
Right 941857753 2:170247911-170247933 ATGGTGAGGAGCACTGTGTGGGG No data
941857747_941857753 24 Left 941857747 2:170247864-170247886 CCTATGAATTTTGAGGGGACATA No data
Right 941857753 2:170247911-170247933 ATGGTGAGGAGCACTGTGTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941857753 Original CRISPR ATGGTGAGGAGCACTGTGTG GGG Intronic
No off target data available for this crispr