ID: 941858553

View in Genome Browser
Species Human (GRCh38)
Location 2:170254637-170254659
Sequence CACCCTGGGAAGTTGGGACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941858553_941858559 -5 Left 941858553 2:170254637-170254659 CCTTGTCCCAACTTCCCAGGGTG No data
Right 941858559 2:170254655-170254677 GGGTGTGAGCACACCACCCAGGG No data
941858553_941858563 16 Left 941858553 2:170254637-170254659 CCTTGTCCCAACTTCCCAGGGTG No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858553_941858558 -6 Left 941858553 2:170254637-170254659 CCTTGTCCCAACTTCCCAGGGTG No data
Right 941858558 2:170254654-170254676 AGGGTGTGAGCACACCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941858553 Original CRISPR CACCCTGGGAAGTTGGGACA AGG (reversed) Intronic
No off target data available for this crispr