ID: 941858558

View in Genome Browser
Species Human (GRCh38)
Location 2:170254654-170254676
Sequence AGGGTGTGAGCACACCACCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941858548_941858558 23 Left 941858548 2:170254608-170254630 CCAGAGGGGTCAGAGGACAAAGC No data
Right 941858558 2:170254654-170254676 AGGGTGTGAGCACACCACCCAGG No data
941858547_941858558 24 Left 941858547 2:170254607-170254629 CCCAGAGGGGTCAGAGGACAAAG No data
Right 941858558 2:170254654-170254676 AGGGTGTGAGCACACCACCCAGG No data
941858550_941858558 1 Left 941858550 2:170254630-170254652 CCACAGGCCTTGTCCCAACTTCC No data
Right 941858558 2:170254654-170254676 AGGGTGTGAGCACACCACCCAGG No data
941858553_941858558 -6 Left 941858553 2:170254637-170254659 CCTTGTCCCAACTTCCCAGGGTG No data
Right 941858558 2:170254654-170254676 AGGGTGTGAGCACACCACCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941858558 Original CRISPR AGGGTGTGAGCACACCACCC AGG Intronic
No off target data available for this crispr