ID: 941858563

View in Genome Browser
Species Human (GRCh38)
Location 2:170254676-170254698
Sequence GGATATTGAGCTGAGATCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941858550_941858563 23 Left 941858550 2:170254630-170254652 CCACAGGCCTTGTCCCAACTTCC No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858557_941858563 1 Left 941858557 2:170254652-170254674 CCAGGGTGTGAGCACACCACCCA No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858556_941858563 2 Left 941858556 2:170254651-170254673 CCCAGGGTGTGAGCACACCACCC No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858553_941858563 16 Left 941858553 2:170254637-170254659 CCTTGTCCCAACTTCCCAGGGTG No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858555_941858563 9 Left 941858555 2:170254644-170254666 CCAACTTCCCAGGGTGTGAGCAC No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data
941858554_941858563 10 Left 941858554 2:170254643-170254665 CCCAACTTCCCAGGGTGTGAGCA No data
Right 941858563 2:170254676-170254698 GGATATTGAGCTGAGATCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941858563 Original CRISPR GGATATTGAGCTGAGATCTG TGG Intronic
No off target data available for this crispr