ID: 941860299 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 2:170272383-170272405 |
| Sequence | CTGGAAGTAGGGAGACCAGC TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 941860299_941860305 | 13 | Left | 941860299 | 2:170272383-170272405 | CCAGCTGGTCTCCCTACTTCCAG | No data | ||
| Right | 941860305 | 2:170272419-170272441 | AATCCATTCCCCACATCAGTTGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 941860299 | Original CRISPR | CTGGAAGTAGGGAGACCAGC TGG (reversed) | Intronic | ||
| No off target data available for this crispr | |||||