ID: 941860299

View in Genome Browser
Species Human (GRCh38)
Location 2:170272383-170272405
Sequence CTGGAAGTAGGGAGACCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941860299_941860305 13 Left 941860299 2:170272383-170272405 CCAGCTGGTCTCCCTACTTCCAG No data
Right 941860305 2:170272419-170272441 AATCCATTCCCCACATCAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941860299 Original CRISPR CTGGAAGTAGGGAGACCAGC TGG (reversed) Intronic
No off target data available for this crispr