ID: 941866166

View in Genome Browser
Species Human (GRCh38)
Location 2:170336968-170336990
Sequence ACCATGAAGTTGAAGGTCAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941866161_941866166 6 Left 941866161 2:170336939-170336961 CCTGCTAAGAAAGACTGTGTTGG No data
Right 941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG No data
941866159_941866166 8 Left 941866159 2:170336937-170336959 CCCCTGCTAAGAAAGACTGTGTT No data
Right 941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG No data
941866160_941866166 7 Left 941866160 2:170336938-170336960 CCCTGCTAAGAAAGACTGTGTTG No data
Right 941866166 2:170336968-170336990 ACCATGAAGTTGAAGGTCAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941866166 Original CRISPR ACCATGAAGTTGAAGGTCAG GGG Intronic
No off target data available for this crispr