ID: 941866278

View in Genome Browser
Species Human (GRCh38)
Location 2:170337997-170338019
Sequence CAACATGGATTTTAACTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941866278_941866283 26 Left 941866278 2:170337997-170338019 CCATGCAGTTAAAATCCATGTTG No data
Right 941866283 2:170338046-170338068 CTCCCTAAGATAGTTCCTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941866278 Original CRISPR CAACATGGATTTTAACTGCA TGG (reversed) Intronic
No off target data available for this crispr