ID: 941867136

View in Genome Browser
Species Human (GRCh38)
Location 2:170346641-170346663
Sequence CACTTTTACTACTGTGCAGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941867136_941867142 29 Left 941867136 2:170346641-170346663 CCAACTGCACAGTAGTAAAAGTG No data
Right 941867142 2:170346693-170346715 TGGCCTTTATAGAGGACTTCAGG No data
941867136_941867140 9 Left 941867136 2:170346641-170346663 CCAACTGCACAGTAGTAAAAGTG No data
Right 941867140 2:170346673-170346695 TGTAATCATCAATGATTTGCTGG No data
941867136_941867141 21 Left 941867136 2:170346641-170346663 CCAACTGCACAGTAGTAAAAGTG No data
Right 941867141 2:170346685-170346707 TGATTTGCTGGCCTTTATAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941867136 Original CRISPR CACTTTTACTACTGTGCAGT TGG (reversed) Intronic
No off target data available for this crispr