ID: 941869369

View in Genome Browser
Species Human (GRCh38)
Location 2:170367468-170367490
Sequence CTGGGGGTGTGCACAACTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941869360_941869369 -4 Left 941869360 2:170367449-170367471 CCCGTTCCCTCTGAGGTTCCTGG No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869362_941869369 -5 Left 941869362 2:170367450-170367472 CCGTTCCCTCTGAGGTTCCTGGG No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869366_941869369 -10 Left 941869366 2:170367455-170367477 CCCTCTGAGGTTCCTGGGGGTGT No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869357_941869369 4 Left 941869357 2:170367441-170367463 CCATCCTACCCGTTCCCTCTGAG No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869354_941869369 22 Left 941869354 2:170367423-170367445 CCAGCAGTTCCTGGACTCCCATC No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869359_941869369 0 Left 941869359 2:170367445-170367467 CCTACCCGTTCCCTCTGAGGTTC No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869356_941869369 5 Left 941869356 2:170367440-170367462 CCCATCCTACCCGTTCCCTCTGA No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data
941869355_941869369 13 Left 941869355 2:170367432-170367454 CCTGGACTCCCATCCTACCCGTT No data
Right 941869369 2:170367468-170367490 CTGGGGGTGTGCACAACTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941869369 Original CRISPR CTGGGGGTGTGCACAACTAC CGG Intronic