ID: 941871151

View in Genome Browser
Species Human (GRCh38)
Location 2:170387235-170387257
Sequence GCCCCCATCACAACTCCAGT TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 128}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941871151_941871154 24 Left 941871151 2:170387235-170387257 CCAACTGGAGTTGTGATGGGGGC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 941871154 2:170387282-170387304 AAAATCCAGAGTTATAAAACAGG 0: 1
1: 0
2: 1
3: 41
4: 446
941871151_941871152 0 Left 941871151 2:170387235-170387257 CCAACTGGAGTTGTGATGGGGGC 0: 1
1: 0
2: 1
3: 8
4: 128
Right 941871152 2:170387258-170387280 AAGAATCTCTGAATATCTCCTGG 0: 1
1: 0
2: 2
3: 12
4: 224

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941871151 Original CRISPR GCCCCCATCACAACTCCAGT TGG (reversed) Exonic
900644583 1:3703169-3703191 GCCCCTGTCACACCCCCAGTGGG - Intronic
902067461 1:13700192-13700214 GCCGCCATCTTGACTCCAGTCGG - Intronic
902860579 1:19242377-19242399 CCCTCCATCACCTCTCCAGTGGG - Exonic
903543830 1:24111361-24111383 GCCCCCATCGCAGCTCCTGGAGG - Intronic
904456143 1:30649385-30649407 GGCCCCATCACGGCTCCTGTGGG - Intergenic
905794060 1:40805532-40805554 ACCCCCATCCCACCTCCAGAGGG - Intronic
906353697 1:45084909-45084931 GCCCCCTTCTCAGCTCCAGTAGG + Intronic
910710649 1:90176421-90176443 GCCCCCACCTCTCCTCCAGTTGG + Intergenic
913022145 1:114798668-114798690 GCCCCCATACCCACTCCATTAGG - Intergenic
916667504 1:166979724-166979746 GCACCCAGCACCACTGCAGTTGG - Intronic
917804972 1:178605368-178605390 GCCCCCACCACAAATCCCTTGGG + Intergenic
922368568 1:224888069-224888091 GCCCCCATAACAACTGTTGTGGG + Intergenic
1067575807 10:47407564-47407586 GCCCCCACCACCTCTCCAATTGG - Intergenic
1070801240 10:79245505-79245527 GACCCCGTCCCAACTCCAATGGG - Intronic
1072009864 10:91293152-91293174 GCCTCCATCCCAGGTCCAGTGGG + Intergenic
1073397234 10:103228178-103228200 GCCCCCTCCACAACACCACTTGG - Intergenic
1074811538 10:117110216-117110238 GCCCCTATCACCACTCCAACTGG + Intronic
1076003707 10:126931584-126931606 GGCCCCACCCCAACCCCAGTGGG - Intronic
1083587461 11:63870650-63870672 GCCTCCTTCACAACTCTTGTTGG - Intronic
1088609366 11:111562692-111562714 GCCCCCTTCAAAACTCAGGTTGG + Intergenic
1088733597 11:112706514-112706536 GACCCCACCACAACCCCAGAAGG - Intergenic
1089520011 11:119057102-119057124 GCGCCCTTCACAACTCCTCTCGG + Exonic
1090187839 11:124749921-124749943 GCCCCACTCCCAACTCCATTAGG + Intronic
1090633639 11:128672986-128673008 ATCCCAATCACAAGTCCAGTAGG + Intergenic
1097514805 12:60591740-60591762 GCCCCCATAAATACTGCAGTTGG + Intergenic
1097750279 12:63345116-63345138 GCCCCCAACAGAATTCCAGTGGG + Intergenic
1102068084 12:109995908-109995930 GCCCCCGTCACCTCCCCAGTTGG + Intronic
1106241700 13:27918313-27918335 GCCCCCACCAAAACTGCAGGTGG + Intergenic
1106487212 13:30182309-30182331 GCCCCCACCACAACTCAAGAGGG + Intergenic
1113658054 13:112082444-112082466 GACCCCCTCACAACTTCAGAAGG - Intergenic
1115516504 14:34190829-34190851 GCCACCATCACCACTCTAGCAGG + Intronic
1117854150 14:60010104-60010126 CCCCCCCTCACAGCTCCAATAGG + Intronic
1119029390 14:71179815-71179837 GCCACCAGCCCAACTCCAATGGG - Intergenic
1119855370 14:77896452-77896474 GCTCCAATCTCAACTCCAGAGGG - Intronic
1120947527 14:90012373-90012395 GCCCTTCTCACAGCTCCAGTAGG + Intronic
1121416677 14:93784039-93784061 GCCACCATCAGGTCTCCAGTGGG + Intronic
1122701733 14:103594188-103594210 GCCCCCAGCAGGGCTCCAGTTGG + Intronic
1122919884 14:104875679-104875701 GCCCCCATCACTGCCCCACTGGG - Intronic
1130386755 15:83418676-83418698 GCAGTCACCACAACTCCAGTTGG - Intergenic
1134739932 16:16533660-16533682 GCACCCATCCCAACTGCAGCTGG - Intergenic
1134927567 16:18178504-18178526 GCACCCATCCCAACTGCAGCTGG + Intergenic
1138943174 16:61814870-61814892 GCCCCCACCTCCACCCCAGTTGG - Intronic
1141591581 16:85072813-85072835 GCCCCCATCCCAGCTGCATTTGG + Intronic
1141946394 16:87313122-87313144 GTCCCAATCAAAATTCCAGTAGG + Intronic
1142985469 17:3692465-3692487 GGCACCATCACAACCCCAGAGGG - Intronic
1143205848 17:5138937-5138959 CCCCCCATCAGAACTCAAGTGGG - Intronic
1143386676 17:6535115-6535137 GGCCCCACCACAACTAGAGTTGG + Intronic
1144960703 17:19042550-19042572 GCCCCCATCACACCACAGGTGGG + Intronic
1144974457 17:19131974-19131996 GCCCCCATCACACCACAGGTGGG - Intronic
1145961064 17:28886824-28886846 GCCCCCATCTCAATCCCAGGAGG + Intronic
1146727974 17:35171008-35171030 GCTCCCACCCCATCTCCAGTTGG + Intronic
1147422279 17:40327860-40327882 GGCCCCCTCCCAACTCCTGTGGG - Intronic
1147565046 17:41530830-41530852 GCCCCCAAAACAACTCCTTTGGG + Intergenic
1154168744 18:12035668-12035690 ACCCCCCTCACATCTCCAGCTGG - Intergenic
1161428142 19:4215903-4215925 GTCCCCACCAAGACTCCAGTGGG - Intronic
1162359193 19:10207371-10207393 GCCCCCATCAGACCTGCAGATGG + Intronic
1162508952 19:11105541-11105563 GCCACCATCACAGCGCCAGCTGG - Exonic
1163273487 19:16268109-16268131 GCAACCATCACCACTCCATTTGG - Intergenic
1166337336 19:42116465-42116487 GCCCCCAACACACCACCAGAGGG + Intronic
1166836404 19:45670437-45670459 TCTCCCATAGCAACTCCAGTGGG + Intronic
1166870193 19:45865991-45866013 GCCCCCAAAACAACTGTAGTTGG - Intronic
1167341342 19:48918351-48918373 GCTCCCCTCACAACTGGAGTCGG + Intronic
1167485125 19:49758301-49758323 GCCCCCCTCACCTCTCCAGCAGG + Intronic
1167787022 19:51645437-51645459 GCTCCCATCACAGCCCCAGAGGG + Intronic
927914027 2:26922854-26922876 GCCCCCATCACAGCTCCTGCAGG + Intronic
930427815 2:51234032-51234054 GCCCTCCTCACAGCTCCACTAGG + Intergenic
931650507 2:64464227-64464249 GCACACATCACAAATCCAGGAGG - Intergenic
932439195 2:71721110-71721132 GCCCTCATCCCAACTTCACTGGG - Intergenic
932775437 2:74525524-74525546 GACACCAGCACCACTCCAGTGGG + Exonic
939080918 2:137661328-137661350 CCCCACATCACATCTCTAGTTGG - Intronic
941871151 2:170387235-170387257 GCCCCCATCACAACTCCAGTTGG - Exonic
943856360 2:192798298-192798320 GCCACCACCAAAACTCCATTAGG + Intergenic
944599560 2:201289666-201289688 ACCCCCATCCCCACTCCAGTAGG + Intronic
1169819193 20:9690195-9690217 GCCCTCTGCACAACTCCACTGGG - Intronic
1171369626 20:24653275-24653297 GCCCCCATGACAACAGCAGCAGG + Intronic
1173586550 20:44187152-44187174 GCCCCCTTCTCCACCCCAGTGGG + Exonic
1178765129 21:35443310-35443332 GCCCCTACTACAACTCCAGATGG + Intronic
1179273135 21:39866760-39866782 GCCCTCCTCACAACCACAGTGGG - Intergenic
1181749071 22:24976467-24976489 GCCCCCAACACAACAACAGGGGG - Intronic
1183210535 22:36448569-36448591 GCCTCCATCACACAGCCAGTGGG - Intergenic
1183373458 22:37448824-37448846 GCCCCCACCACCCCTCCAGAGGG + Intergenic
1183566579 22:38619752-38619774 GCTCCCATCACTACTGCAGTAGG - Intronic
1184193495 22:42910731-42910753 GCCCCCCTCACCCCTCCAGAAGG + Intronic
951858463 3:27224398-27224420 GCCCCCACAACACTTCCAGTGGG + Intronic
968546713 4:1202675-1202697 GCCCCCACCTCAGCTCCGGTGGG + Intronic
969487543 4:7480706-7480728 GCCCTCCCCACAACTCCAGGTGG - Intronic
969703045 4:8778127-8778149 GCCCCCATCACAGCTGCTGGGGG - Intergenic
972940614 4:44190733-44190755 CCCCCAATCCCAACTACAGTAGG + Intronic
975019836 4:69472817-69472839 GGCCCCATCAAGACTTCAGTTGG - Intergenic
975082675 4:70299655-70299677 GCCACCACCACAACTGCAGCTGG + Intergenic
976096031 4:81509292-81509314 ATCACCATGACAACTCCAGTAGG - Intronic
981650663 4:147054203-147054225 ATCCCCATCTCACCTCCAGTGGG - Intergenic
983340795 4:166458319-166458341 GCCCCCATCACGACTCCAGAGGG + Intergenic
986195418 5:5533341-5533363 TCCCCCATCCCGACCCCAGTAGG + Intergenic
990254573 5:53953540-53953562 GCACTGATCACAACTACAGTTGG - Intronic
994880898 5:105494115-105494137 GCTCCTATCACAACTCTAATGGG + Intergenic
996354379 5:122579952-122579974 TCCCTCATCACAAATACAGTGGG + Intergenic
997952088 5:138250328-138250350 GCCTCCCTGAAAACTCCAGTGGG - Intergenic
999418753 5:151422221-151422243 GCCCACATCCCATCTCCAGCTGG - Intergenic
1001453392 5:171843053-171843075 GCCCCCATCTCCTCTCCAGATGG - Intergenic
1002387317 5:178878017-178878039 CTCCCCATCAGAACTCCAGATGG - Intronic
1003019886 6:2500638-2500660 GCCCCCAAGACAACTCCCATTGG + Intergenic
1004044833 6:12012985-12013007 GCCCCCTTCCCAACTGCAGCTGG - Intronic
1007760457 6:44130302-44130324 CTCCCCATCACAACCCCAGGAGG - Intronic
1010673044 6:78709367-78709389 GCCACCATGACACCACCAGTAGG - Intergenic
1012491723 6:99789524-99789546 GCACTCCACACAACTCCAGTGGG - Intergenic
1013367599 6:109447356-109447378 ACCCCCATCCCAACACCAGGAGG - Exonic
1015599105 6:134895215-134895237 GCCCCCATCCCAACTCAAAAAGG + Intergenic
1015777761 6:136831977-136831999 TCTCTCCTCACAACTCCAGTAGG + Intronic
1018291010 6:162292662-162292684 GACCCCATCACACATCCTGTGGG - Intronic
1021560084 7:21960943-21960965 GCCCCCATCAGAAACCCAATTGG + Intergenic
1021858330 7:24880070-24880092 AACCCCATCACCACCCCAGTGGG - Intronic
1023481412 7:40638760-40638782 ATCCCCATCACACCTCCAGAAGG - Intronic
1024729251 7:52236053-52236075 GCCCTCTTCACAGCTCCACTTGG - Intergenic
1024786728 7:52915827-52915849 ATCCCCATCAAAATTCCAGTGGG - Intergenic
1025221588 7:57114970-57114992 GGCCTTCTCACAACTCCAGTAGG + Intergenic
1025225857 7:57162043-57162065 GGCCTTCTCACAACTCCAGTTGG + Intergenic
1025632371 7:63286638-63286660 GGCCTTCTCACAACTCCAGTAGG + Intergenic
1025650190 7:63459595-63459617 GGCCTTCTCACAACTCCAGTAGG - Intergenic
1025721600 7:64020688-64020710 GGCCTTCTCACAACTCCAGTTGG - Intergenic
1027755479 7:82205379-82205401 GCCCCCATTACTACTCTAATAGG - Intronic
1027873127 7:83735021-83735043 GCCACAAACACAACTCCAGGGGG - Intergenic
1029024906 7:97406081-97406103 TCTCCCATAACAACTCCACTGGG - Intergenic
1031282239 7:119818929-119818951 GCCCTCTTCACAGCTCCACTGGG - Intergenic
1031983765 7:128148797-128148819 GCCCCCACCCCTACCCCAGTGGG - Intergenic
1045690051 8:104751168-104751190 TTCCCCATCCCAGCTCCAGTTGG + Intronic
1049252059 8:141594480-141594502 GCCCTCATCACAAGGCCACTGGG - Intergenic
1055782305 9:79832859-79832881 GCCCTCTTCACAGCTCCACTAGG + Intergenic
1056169126 9:83965844-83965866 GACCCCATCACAAGTCCCATTGG + Intergenic
1062676735 9:137750696-137750718 GTCCCCACCACTACTCCAGAGGG - Intronic
1189465848 X:41276960-41276982 GCCCCCATCCCCACCCCAGCAGG - Intergenic
1192231967 X:69271608-69271630 GCCCCCATCACAACTCTCATTGG + Intergenic
1192849958 X:74944157-74944179 GACCCCATCAAAATTCCAGCTGG - Intergenic
1194692231 X:97001193-97001215 GTTCCCTTCACAACACCAGTGGG + Intronic
1198700032 X:139386817-139386839 GCCCCCATCATAACACCATGAGG - Intergenic
1199027858 X:142961029-142961051 CCTCTCCTCACAACTCCAGTAGG + Intergenic
1199838538 X:151619358-151619380 GCCCCCATGATAACTCAACTTGG - Intronic
1200397205 X:155998275-155998297 GCCCCACACACAGCTCCAGTGGG - Intronic