ID: 941878918

View in Genome Browser
Species Human (GRCh38)
Location 2:170462020-170462042
Sequence ACCAGATGGGTCCACTCTGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941878918_941878923 9 Left 941878918 2:170462020-170462042 CCTCCAGAGTGGACCCATCTGGT No data
Right 941878923 2:170462052-170462074 GAGAGTATAACACGCTCTGCAGG No data
941878918_941878925 18 Left 941878918 2:170462020-170462042 CCTCCAGAGTGGACCCATCTGGT No data
Right 941878925 2:170462061-170462083 ACACGCTCTGCAGGTGGTGCTGG No data
941878918_941878924 12 Left 941878918 2:170462020-170462042 CCTCCAGAGTGGACCCATCTGGT No data
Right 941878924 2:170462055-170462077 AGTATAACACGCTCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941878918 Original CRISPR ACCAGATGGGTCCACTCTGG AGG (reversed) Intronic