ID: 941883983

View in Genome Browser
Species Human (GRCh38)
Location 2:170509607-170509629
Sequence TTATATACACAAATGAATCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941883983_941883985 12 Left 941883983 2:170509607-170509629 CCTTGATTCATTTGTGTATATAA No data
Right 941883985 2:170509642-170509664 GCTCAAAATTGTTAAGACTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941883983 Original CRISPR TTATATACACAAATGAATCA AGG (reversed) Intronic
No off target data available for this crispr