ID: 941886997

View in Genome Browser
Species Human (GRCh38)
Location 2:170538436-170538458
Sequence GTCACCATGGTCCAGGGACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941886997_941887002 -5 Left 941886997 2:170538436-170538458 CCCAGTCCCTGGACCATGGTGAC No data
Right 941887002 2:170538454-170538476 GTGACTTCACCTAGTGCCACCGG No data
941886997_941887006 18 Left 941886997 2:170538436-170538458 CCCAGTCCCTGGACCATGGTGAC No data
Right 941887006 2:170538477-170538499 CGCAGCGTGACAGAGCCAGCTGG No data
941886997_941887007 26 Left 941886997 2:170538436-170538458 CCCAGTCCCTGGACCATGGTGAC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941886997 Original CRISPR GTCACCATGGTCCAGGGACT GGG (reversed) Intronic
No off target data available for this crispr