ID: 941887000

View in Genome Browser
Species Human (GRCh38)
Location 2:170538443-170538465
Sequence AGGTGAAGTCACCATGGTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887000_941887006 11 Left 941887000 2:170538443-170538465 CCTGGACCATGGTGACTTCACCT No data
Right 941887006 2:170538477-170538499 CGCAGCGTGACAGAGCCAGCTGG No data
941887000_941887007 19 Left 941887000 2:170538443-170538465 CCTGGACCATGGTGACTTCACCT No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887000 Original CRISPR AGGTGAAGTCACCATGGTCC AGG (reversed) Intronic
No off target data available for this crispr