ID: 941887003

View in Genome Browser
Species Human (GRCh38)
Location 2:170538463-170538485
Sequence CACGCTGCGCCGGTGGCACT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887003_941887011 20 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887003_941887006 -9 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887006 2:170538477-170538499 CGCAGCGTGACAGAGCCAGCTGG No data
941887003_941887010 19 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887010 2:170538505-170538527 TGGATCTCTGCTGCAGAAGAAGG No data
941887003_941887013 30 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887003_941887007 -1 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941887003_941887012 29 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887012 2:170538515-170538537 CTGCAGAAGAAGGGAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887003 Original CRISPR CACGCTGCGCCGGTGGCACT AGG (reversed) Intronic
No off target data available for this crispr