ID: 941887004

View in Genome Browser
Species Human (GRCh38)
Location 2:170538470-170538492
Sequence GCTCTGTCACGCTGCGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887004_941887012 22 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887012 2:170538515-170538537 CTGCAGAAGAAGGGAGATGCTGG No data
941887004_941887011 13 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887004_941887007 -8 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941887004_941887013 23 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887004_941887010 12 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887010 2:170538505-170538527 TGGATCTCTGCTGCAGAAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887004 Original CRISPR GCTCTGTCACGCTGCGCCGG TGG (reversed) Intronic
No off target data available for this crispr