ID: 941887005

View in Genome Browser
Species Human (GRCh38)
Location 2:170538473-170538495
Sequence CTGGCTCTGTCACGCTGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887005_941887013 20 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887005_941887010 9 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887010 2:170538505-170538527 TGGATCTCTGCTGCAGAAGAAGG No data
941887005_941887011 10 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887005_941887012 19 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887012 2:170538515-170538537 CTGCAGAAGAAGGGAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887005 Original CRISPR CTGGCTCTGTCACGCTGCGC CGG (reversed) Intronic
No off target data available for this crispr