ID: 941887007

View in Genome Browser
Species Human (GRCh38)
Location 2:170538485-170538507
Sequence GACAGAGCCAGCTGGCCTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887004_941887007 -8 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941886998_941887007 25 Left 941886998 2:170538437-170538459 CCAGTCCCTGGACCATGGTGACT No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941887003_941887007 -1 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941886999_941887007 20 Left 941886999 2:170538442-170538464 CCCTGGACCATGGTGACTTCACC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941887000_941887007 19 Left 941887000 2:170538443-170538465 CCTGGACCATGGTGACTTCACCT No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941887001_941887007 13 Left 941887001 2:170538449-170538471 CCATGGTGACTTCACCTAGTGCC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data
941886997_941887007 26 Left 941886997 2:170538436-170538458 CCCAGTCCCTGGACCATGGTGAC No data
Right 941887007 2:170538485-170538507 GACAGAGCCAGCTGGCCTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887007 Original CRISPR GACAGAGCCAGCTGGCCTCA TGG Intronic
No off target data available for this crispr