ID: 941887008

View in Genome Browser
Species Human (GRCh38)
Location 2:170538492-170538514
Sequence CAGAGATCCATGAGGCCAGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887008_941887011 -9 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887008_941887013 1 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887008_941887014 26 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887014 2:170538541-170538563 TTCTCAGCAGCCAGCTACTCAGG No data
941887008_941887010 -10 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887010 2:170538505-170538527 TGGATCTCTGCTGCAGAAGAAGG No data
941887008_941887012 0 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887012 2:170538515-170538537 CTGCAGAAGAAGGGAGATGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887008 Original CRISPR CAGAGATCCATGAGGCCAGC TGG (reversed) Intronic
No off target data available for this crispr