ID: 941887011

View in Genome Browser
Species Human (GRCh38)
Location 2:170538506-170538528
Sequence GGATCTCTGCTGCAGAAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887005_941887011 10 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887004_941887011 13 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887003_941887011 20 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data
941887008_941887011 -9 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887011 2:170538506-170538528 GGATCTCTGCTGCAGAAGAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887011 Original CRISPR GGATCTCTGCTGCAGAAGAA GGG Intronic
No off target data available for this crispr