ID: 941887013

View in Genome Browser
Species Human (GRCh38)
Location 2:170538516-170538538
Sequence TGCAGAAGAAGGGAGATGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887003_941887013 30 Left 941887003 2:170538463-170538485 CCTAGTGCCACCGGCGCAGCGTG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887004_941887013 23 Left 941887004 2:170538470-170538492 CCACCGGCGCAGCGTGACAGAGC No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887005_941887013 20 Left 941887005 2:170538473-170538495 CCGGCGCAGCGTGACAGAGCCAG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887009_941887013 -7 Left 941887009 2:170538500-170538522 CCTCATGGATCTCTGCTGCAGAA No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data
941887008_941887013 1 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887013 2:170538516-170538538 TGCAGAAGAAGGGAGATGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887013 Original CRISPR TGCAGAAGAAGGGAGATGCT GGG Intronic
No off target data available for this crispr