ID: 941887014

View in Genome Browser
Species Human (GRCh38)
Location 2:170538541-170538563
Sequence TTCTCAGCAGCCAGCTACTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941887008_941887014 26 Left 941887008 2:170538492-170538514 CCAGCTGGCCTCATGGATCTCTG No data
Right 941887014 2:170538541-170538563 TTCTCAGCAGCCAGCTACTCAGG No data
941887009_941887014 18 Left 941887009 2:170538500-170538522 CCTCATGGATCTCTGCTGCAGAA No data
Right 941887014 2:170538541-170538563 TTCTCAGCAGCCAGCTACTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941887014 Original CRISPR TTCTCAGCAGCCAGCTACTC AGG Intronic
No off target data available for this crispr