ID: 941890459

View in Genome Browser
Species Human (GRCh38)
Location 2:170575692-170575714
Sequence CCTCTGGGTAACAAGATTAT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
941890455_941890459 -6 Left 941890455 2:170575675-170575697 CCTAAAATAGTCAGTTACCTCTG No data
Right 941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG No data
941890454_941890459 -5 Left 941890454 2:170575674-170575696 CCCTAAAATAGTCAGTTACCTCT No data
Right 941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG No data
941890453_941890459 20 Left 941890453 2:170575649-170575671 CCAATTGATATTATGGACAAACA No data
Right 941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG No data
941890452_941890459 21 Left 941890452 2:170575648-170575670 CCCAATTGATATTATGGACAAAC No data
Right 941890459 2:170575692-170575714 CCTCTGGGTAACAAGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
941890459 Original CRISPR CCTCTGGGTAACAAGATTAT AGG Intronic
No off target data available for this crispr